ID: 1178396475

View in Genome Browser
Species Human (GRCh38)
Location 21:32247872-32247894
Sequence GGGTGCCTATATGAATCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178396475_1178396481 4 Left 1178396475 21:32247872-32247894 CCGGAAGATTCATATAGGCACCC No data
Right 1178396481 21:32247899-32247921 CCCATCCTACTCAGGCTTCCAGG No data
1178396475_1178396487 24 Left 1178396475 21:32247872-32247894 CCGGAAGATTCATATAGGCACCC No data
Right 1178396487 21:32247919-32247941 AGGCTGGGAGCCTGCCCCTCTGG No data
1178396475_1178396483 8 Left 1178396475 21:32247872-32247894 CCGGAAGATTCATATAGGCACCC No data
Right 1178396483 21:32247903-32247925 TCCTACTCAGGCTTCCAGGCTGG No data
1178396475_1178396485 9 Left 1178396475 21:32247872-32247894 CCGGAAGATTCATATAGGCACCC No data
Right 1178396485 21:32247904-32247926 CCTACTCAGGCTTCCAGGCTGGG No data
1178396475_1178396476 -4 Left 1178396475 21:32247872-32247894 CCGGAAGATTCATATAGGCACCC No data
Right 1178396476 21:32247891-32247913 ACCCAGTCCCCATCCTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178396475 Original CRISPR GGGTGCCTATATGAATCTTC CGG (reversed) Intergenic
No off target data available for this crispr