ID: 1178399262

View in Genome Browser
Species Human (GRCh38)
Location 21:32270233-32270255
Sequence CCAATACCAAATAAAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178399258_1178399262 29 Left 1178399258 21:32270181-32270203 CCAAAAATTTTCTCACAGTGTTT 0: 1
1: 0
2: 5
3: 54
4: 639
Right 1178399262 21:32270233-32270255 CCAATACCAAATAAAGAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 227
1178399259_1178399262 3 Left 1178399259 21:32270207-32270229 CCTACAATTTAGAGTGTCTGACT 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1178399262 21:32270233-32270255 CCAATACCAAATAAAGAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178399262 Original CRISPR CCAATACCAAATAAAGAAGG AGG Intronic
902767612 1:18627845-18627867 CCAAGACCAAGCAGAGAAGGAGG + Intergenic
902998213 1:20244270-20244292 CCAACAAGAAAAAAAGAAGGTGG - Intergenic
904460778 1:30678490-30678512 CCATTACCAGATGAAGGAGGAGG + Intergenic
906745496 1:48219178-48219200 CCTATGCCAAAGAAAGAAGTTGG - Intergenic
906907223 1:49908754-49908776 CCTGTATCAAATAAAAAAGGGGG + Intronic
909312490 1:74170603-74170625 CAAAAACCAAATAAAGCTGGAGG - Intronic
915035693 1:152922169-152922191 CCAATACCCAAGAAAGGAGGTGG + Intergenic
915883319 1:159697005-159697027 CCAATACAAAAAAAAGTAGGGGG + Intergenic
915922683 1:159988584-159988606 ACAGTACCAATCAAAGAAGGTGG + Intergenic
916609359 1:166375481-166375503 CCAATTCCAGAGAAAGAAGGAGG - Intergenic
917130021 1:171731766-171731788 CAAATACCAAATAAAGGATGGGG + Intronic
919018697 1:192075403-192075425 CCACTCCCAAATATGGAAGGAGG + Intergenic
919170633 1:193949269-193949291 CCAATATCTCAAAAAGAAGGTGG + Intergenic
923042950 1:230332922-230332944 CCAGTACCAAATCAAGATGAAGG - Exonic
1065718186 10:28594658-28594680 CCAAGACAAAACAACGAAGGAGG - Intronic
1065768984 10:29059169-29059191 CCAAAAACAAAAAAAGAAGAAGG + Intergenic
1067690924 10:48501739-48501761 CCAAAAAAAAAAAAAGAAGGTGG + Intronic
1067913559 10:50372202-50372224 CGAATACTAGAGAAAGAAGGTGG + Intronic
1067929376 10:50544914-50544936 CCAACCACAAATAAAGATGGAGG - Intronic
1069664222 10:70144347-70144369 CCAACACCAAACAAAGTGGGAGG + Intronic
1069949427 10:72008852-72008874 TTAACACCAAATAAAGCAGGAGG - Exonic
1070338045 10:75472280-75472302 CCAAAACCAGGTAATGAAGGAGG + Intronic
1071075670 10:81748988-81749010 CCAATACCACAGATATAAGGAGG - Intergenic
1071469554 10:85973587-85973609 AAAATAGCAAATAATGAAGGGGG - Intronic
1073470816 10:103721038-103721060 CCAATACCACCTCAAGAAAGAGG + Intronic
1073491242 10:103854975-103854997 CCAATGCCAAAAAAAGAAACCGG + Intronic
1075246813 10:120829935-120829957 CCAACCCCTGATAAAGAAGGAGG + Intergenic
1078494351 11:11801114-11801136 CCATAACCAAATGAAGAAAGTGG + Intergenic
1079583405 11:22094439-22094461 TCAAAAACAAAAAAAGAAGGTGG + Intergenic
1080137808 11:28877762-28877784 CCAATACAACATAAAATAGGAGG - Intergenic
1080171449 11:29307930-29307952 CCAATCCCAGAGAGAGAAGGAGG - Intergenic
1084083021 11:66841503-66841525 CCAATAACAAGTAAAGACAGTGG - Intronic
1086285435 11:85243888-85243910 CAAGTACCAAATGAAGAAAGTGG - Intronic
1087175089 11:95089174-95089196 CCGATACCAAGCAAGGAAGGAGG - Intergenic
1087367818 11:97243718-97243740 TGAAGACCAAATCAAGAAGGCGG - Intergenic
1087963092 11:104376262-104376284 AAAATACCATATGAAGAAGGAGG - Intergenic
1088031153 11:105252400-105252422 CAATTGCCAAATAAACAAGGTGG - Intergenic
1088825417 11:113489849-113489871 TCTATACCAAAGAAGGAAGGTGG - Intergenic
1089457322 11:118633228-118633250 CCCACACCAAGAAAAGAAGGAGG - Intronic
1093260898 12:16936524-16936546 CCAATTCCAAAAAATCAAGGAGG - Intergenic
1095869358 12:47009311-47009333 TCATTAAAAAATAAAGAAGGTGG + Intergenic
1096608033 12:52781030-52781052 CAAGTACCAGATAAAGAATGAGG - Intergenic
1098283840 12:68888276-68888298 CCAATATTATTTAAAGAAGGAGG + Intronic
1098399199 12:70055166-70055188 ATAATAATAAATAAAGAAGGAGG - Intergenic
1098563067 12:71899967-71899989 ACAAAACCAAAAAAAGTAGGTGG + Intronic
1099210662 12:79784155-79784177 TCAATGCCAAAAAAAAAAGGTGG + Intronic
1100019451 12:90051497-90051519 CCCAAACTAAATAAAGAAGTAGG - Intergenic
1100134718 12:91541544-91541566 CAGATGCCAAATAATGAAGGTGG - Intergenic
1100375259 12:94009046-94009068 CAGATACAAAATAAAAAAGGTGG - Intergenic
1100852997 12:98733132-98733154 CCAAAAACAAAAAAAAAAGGTGG - Exonic
1101233397 12:102764750-102764772 GTAATACCAAATTGAGAAGGAGG - Intergenic
1101784419 12:107870515-107870537 CCACCACCAAAAAAAAAAGGTGG + Intergenic
1101848181 12:108380403-108380425 TCAAGACCATATAAACAAGGAGG - Intergenic
1102161487 12:110772592-110772614 CCAACACAAATTAAAGAAAGAGG + Intergenic
1102558254 12:113743040-113743062 CCAAAACCAAATAAGGATGAAGG + Intergenic
1105893952 13:24702522-24702544 CTATTACCAAATAAAAAAGAAGG - Intronic
1105906403 13:24814565-24814587 CCAATTCAAAATAATGAAGCTGG - Intronic
1108264148 13:48687923-48687945 CCACGACCAAATAAAGAAAAAGG - Intronic
1109093770 13:58084444-58084466 CCAATATCCAATAAAGTAAGTGG - Intergenic
1109473689 13:62848031-62848053 CTAATATCAAATAAAGAACATGG - Intergenic
1110816695 13:79868683-79868705 CAAAAACCAAAGAAAAAAGGAGG - Intergenic
1111283711 13:86061975-86061997 AAAATACCAAAAAAACAAGGTGG + Intergenic
1112349827 13:98623638-98623660 CAGATACCAAATAAGGAACGTGG - Intergenic
1112938083 13:104825750-104825772 TCTATACCAACTGAAGAAGGAGG - Intergenic
1113583138 13:111443008-111443030 CTAATTCCAAATAAAGAGAGTGG - Intergenic
1114337945 14:21712403-21712425 ACAAAACCAAATAGTGAAGGAGG - Intergenic
1114675672 14:24438771-24438793 CCAAGACCAGATAAAGAAGTAGG + Exonic
1116037243 14:39642016-39642038 CAAAGACCAAAAAAAAAAGGGGG - Intergenic
1118480612 14:66161522-66161544 CCTATACCAAAAAAAAAATGTGG - Intergenic
1119081927 14:71702783-71702805 GCAAAAACAAATAAACAAGGGGG - Intronic
1120625575 14:86821543-86821565 CCAATAACAAACAACAAAGGAGG + Intergenic
1120818994 14:88894646-88894668 CAAAAACAAAAAAAAGAAGGAGG - Intergenic
1122845646 14:104496473-104496495 GCAATATCAAATAAAAATGGTGG - Intronic
1123802940 15:23840462-23840484 CCAAGAACAAATATAGAAGGTGG - Intergenic
1124697136 15:31873221-31873243 CCAATATCAAAAAATGAAAGAGG - Intergenic
1125643259 15:41249170-41249192 CAAAAACCAAAAAAAGAAGGTGG - Intronic
1126403204 15:48295557-48295579 CAAATACCAAATTAACATGGTGG - Intronic
1126422865 15:48493308-48493330 CCAATGCCAAAAAAAAAAGAGGG + Intronic
1126972343 15:54130661-54130683 CCTATACCAAATACAGATGTAGG - Intronic
1127363054 15:58261801-58261823 GCAAAACCAAATAAATAATGTGG - Intronic
1128846898 15:70906831-70906853 CAAATAACAAATAAAAAAGATGG - Intronic
1130663045 15:85845701-85845723 CCAATACCAGATGAAGAGAGAGG - Intergenic
1131521626 15:93120622-93120644 CCAATGCCAAATAAAAATGTGGG + Intergenic
1131576675 15:93599169-93599191 CCAACACCAAAACATGAAGGCGG - Intergenic
1131934568 15:97489124-97489146 CCAAAACCAAATAAATAATCTGG - Intergenic
1133687639 16:8181240-8181262 CCAATAACAAATGAAAAAGCTGG + Intergenic
1136869893 16:33796999-33797021 ACAATAACACATAAAGAAGCTGG - Intergenic
1137356245 16:47767909-47767931 CCAATACCAAAGAGCAAAGGTGG + Intergenic
1137922760 16:52507195-52507217 CCATGACAAAATAAAGGAGGGGG + Intronic
1138938110 16:61755810-61755832 CCACCACCAAAAAAAGAAGAAGG - Intronic
1139314675 16:66058065-66058087 CCAATTTCAAATAATTAAGGAGG + Intergenic
1141626443 16:85264054-85264076 GCACTACCAGATACAGAAGGCGG + Intergenic
1141866732 16:86755488-86755510 CAGATACCAAATAAAGACAGAGG - Intergenic
1203102279 16_KI270728v1_random:1319056-1319078 ACAATAACACATAAAGAAGCTGG + Intergenic
1142657153 17:1401667-1401689 CCAAGATCAAATAAAGATTGTGG + Intergenic
1145194359 17:20876087-20876109 CTAATACAAAAGAAAGGAGGAGG - Intronic
1145940336 17:28740292-28740314 AAAATAAAAAATAAAGAAGGAGG + Intronic
1148218549 17:45847160-45847182 CCACCCCCAAATAATGAAGGGGG + Intergenic
1152507059 17:80756503-80756525 CCAACACAAAAGATAGAAGGTGG + Intronic
1156209781 18:34927078-34927100 CCAGTAACAAATAAAGAAATAGG + Intergenic
1156215001 18:34989123-34989145 CCCAAACCAAAAAAGGAAGGAGG + Intronic
1158094338 18:53753926-53753948 CCAATACTAAAAGAAGAAAGTGG + Intergenic
1159008632 18:63037542-63037564 ACAAAACAAAAGAAAGAAGGGGG - Intergenic
1159043320 18:63345486-63345508 CCAATACCAAATAAAAATCATGG - Intronic
1159524223 18:69567469-69567491 CCATTACCAAAAAAAAAATGAGG + Intronic
1159637683 18:70825422-70825444 TCAAGACAAAACAAAGAAGGGGG + Intergenic
1159976689 18:74721827-74721849 ACATACCCAAATAAAGAAGGTGG - Intronic
1160319931 18:77880700-77880722 CCAGTACCAAATATACAAGGGGG + Intergenic
1160484363 18:79275278-79275300 GCAATACTCAAGAAAGAAGGAGG - Intronic
1164463531 19:28468628-28468650 GCAATCCCAAAGAAAGAAGCAGG + Intergenic
929178288 2:39004106-39004128 ACAATACATATTAAAGAAGGAGG + Intronic
929178729 2:39009598-39009620 CCAATAATACACAAAGAAGGTGG + Intronic
931304031 2:61010648-61010670 ACAATACCTAATAAAGTACGTGG - Intronic
931527306 2:63170761-63170783 CCAATACCACAAAAATAAGCAGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935527917 2:104194727-104194749 CAAATACAAAATAAACAATGGGG + Intergenic
937520308 2:122705870-122705892 CCACAACCAAATGAAGGAGGAGG - Intergenic
937687600 2:124715483-124715505 GGAATACCAAAGAAAAAAGGAGG + Intronic
941562665 2:167068094-167068116 TCAATTGCAAATAAAAAAGGTGG - Intronic
942989221 2:182179001-182179023 GCAATGCCATCTAAAGAAGGAGG + Intronic
943638440 2:190332467-190332489 CCTATGGCAGATAAAGAAGGAGG + Intronic
944178334 2:196859028-196859050 CCAATAACAAATAATGAGGCTGG + Intronic
944282627 2:197915289-197915311 ACAATACCACATAAAGTAGCAGG + Intronic
946383906 2:219369949-219369971 CAAATACAAGAGAAAGAAGGAGG + Intergenic
946401329 2:219469902-219469924 CAAATAGCAAATAACGAAGAAGG + Intronic
947501485 2:230674456-230674478 CCAATAGGATATAAACAAGGTGG + Intergenic
948609486 2:239157685-239157707 CCAATTCCAAATAAGTAAGTCGG - Intronic
1172321697 20:33999989-34000011 CCAATGCCAAACTAAGAAGGGGG - Intronic
1175014445 20:55774179-55774201 CCAAACCCAAATATACAAGGAGG + Intergenic
1177482752 21:21712948-21712970 GCATGACCAAATAGAGAAGGTGG + Intergenic
1178399262 21:32270233-32270255 CCAATACCAAATAAAGAAGGAGG + Intronic
1178547401 21:33503862-33503884 GCAATACCAAAAAAAAAAAGAGG + Intergenic
1179203515 21:39249893-39249915 CCAAGATCAAAAAAAGAAGGGGG + Intronic
1182681825 22:32085424-32085446 ACCATAACAAATAAAGAAGAGGG - Intronic
1184251267 22:43261689-43261711 CCAACTCCCAATAGAGAAGGTGG - Intronic
951141470 3:19167000-19167022 ACAATACCTAATAATGCAGGAGG - Intronic
952012772 3:28919952-28919974 CCAATGCCAAATAAATGAGAGGG - Intergenic
952405214 3:32999091-32999113 CCAATGCCTACAAAAGAAGGGGG + Intronic
953475671 3:43203821-43203843 CCAGTACAAAATAAAAAAGTAGG + Intergenic
959575874 3:107932873-107932895 TCAAAACCAAGTAGAGAAGGAGG - Intergenic
961699336 3:128729954-128729976 CCAATAGCCAAAAAATAAGGGGG - Intronic
965978150 3:174651795-174651817 CCATTTAAAAATAAAGAAGGTGG - Intronic
967544802 3:190712511-190712533 CAAATAACAAATTAAGATGGGGG + Intergenic
968895615 4:3401194-3401216 CCAACACCAAATTAATAAGATGG + Intronic
969062691 4:4450602-4450624 CAAATAATAAATACAGAAGGAGG - Intronic
969302045 4:6302822-6302844 CCAACACAAAAGAAAGAAAGAGG - Exonic
969888927 4:10241720-10241742 CCCTTACCAAATAAAGATGTGGG - Intergenic
971678195 4:29663084-29663106 ACAATAACAAATCAAGAAAGTGG + Intergenic
972004406 4:34081081-34081103 CCAATACCAACATAAGAAAGAGG - Intergenic
972750911 4:41987820-41987842 CCATTACAAAATAAAGTAAGTGG - Intergenic
973940276 4:55901962-55901984 CCAAGTCCAAAAAAAGAAGGGGG + Intronic
974540540 4:63227555-63227577 CCAAAACCAAATAAAAAGAGAGG + Intergenic
975125701 4:70779872-70779894 ACAATTAGAAATAAAGAAGGTGG - Intronic
975391246 4:73820254-73820276 TCAACACAAAATGAAGAAGGTGG + Intergenic
976155891 4:82144503-82144525 CTACTACAAAATAAAGCAGGGGG + Intergenic
977831846 4:101603584-101603606 CACATACTAAATAAAGAAGCAGG + Intronic
979573684 4:122260411-122260433 CCAATACCAAATAGAAAAAATGG + Intronic
979590998 4:122480210-122480232 CCAAAACCAAAAAAGGAAGGGGG + Intergenic
980220604 4:129909010-129909032 ATAATACCACATAAAGAAGTGGG - Intergenic
981186431 4:141808987-141809009 CCAATACAGAATAAGGAAGTAGG + Intergenic
981425017 4:144593290-144593312 CCAAGTCCAAATAAAGAAAGGGG + Intergenic
982627263 4:157782882-157782904 CTAAAAGCAAATAAAGAAGGGGG - Intergenic
983048728 4:163018885-163018907 CCAATACAAAATAAAGGAAGGGG + Intergenic
984447347 4:179853581-179853603 CCAATACCAATTACAGAAAAGGG + Intergenic
987489777 5:18564276-18564298 CAAAGACCAAAAAAAGTAGGTGG - Intergenic
988101303 5:26682493-26682515 GCAAGACCAACTAAAGGAGGAGG + Intergenic
988825050 5:34928173-34928195 CCAAAACCAAATCAAGTTGGAGG + Intergenic
989396738 5:40965035-40965057 ACATTACCAACTAGAGAAGGCGG - Intronic
989457294 5:41658789-41658811 CCATTCCCAAATAAAGAGGTAGG + Intergenic
991942152 5:71863347-71863369 CCACTACCAGATGCAGAAGGAGG + Intergenic
992315177 5:75545036-75545058 CCCATACCAAATAAATCAGAAGG - Intronic
992424044 5:76637374-76637396 ACAAAACCAAATAGAGCAGGGGG + Intronic
993097489 5:83496635-83496657 CCAAGAGCCAATAAACAAGGAGG - Intronic
993172766 5:84440701-84440723 CCAATTAAAACTAAAGAAGGAGG + Intergenic
994097691 5:95861898-95861920 CCAATTCATCATAAAGAAGGGGG - Intergenic
994296185 5:98091022-98091044 GCAATACCCAAGAAAGAAGTAGG - Intergenic
996249646 5:121313869-121313891 ACAATACCTAATAAAGACTGTGG + Intergenic
996495946 5:124156719-124156741 CCAGTGCCAAATAATGAAGTGGG + Intergenic
996578050 5:124998484-124998506 CTAATAGGCAATAAAGAAGGGGG + Intergenic
998240619 5:140440382-140440404 CCACTACCAAAAAGGGAAGGAGG - Intronic
999044001 5:148448180-148448202 CCAATACCAAAGAGATAAGTGGG + Intergenic
999162614 5:149516368-149516390 CAAAAACCAAAAAAAGTAGGGGG + Intronic
999574999 5:152966240-152966262 AGACTCCCAAATAAAGAAGGAGG - Intergenic
1001005975 5:168050476-168050498 CCTACACCAAAAAAAGGAGGCGG - Intronic
1004254230 6:14048339-14048361 AGAAAACCAAATCAAGAAGGTGG + Intergenic
1007181627 6:39933218-39933240 CCAGTACAAAATAAACTAGGGGG + Intronic
1008338862 6:50340103-50340125 CCAAGACAAGTTAAAGAAGGAGG - Intergenic
1009260273 6:61477486-61477508 CCAATATAAAATCTAGAAGGAGG + Intergenic
1009525786 6:64743831-64743853 ACAATACCAAATTAATAAGGGGG + Intronic
1010368816 6:75083823-75083845 CCAATATCAATTAAAGAGAGAGG - Intergenic
1011014323 6:82737854-82737876 CCAATACCGATAAAAGAAGACGG + Intergenic
1014633988 6:123822302-123822324 CGAATAGCAAATAAAGAACTAGG - Intronic
1015088573 6:129327208-129327230 CCAAATCAAAATAAACAAGGAGG + Intronic
1015114279 6:129629876-129629898 CTAAAAGCAAAAAAAGAAGGAGG + Intronic
1017327532 6:153156652-153156674 AAAATACTAAATAAAGAAGCAGG - Intergenic
1017417009 6:154231713-154231735 CCAAAAACAAATAGAAAAGGGGG + Intronic
1020824934 7:13015691-13015713 CAAATACAAGATAAAAAAGGAGG - Intergenic
1021318805 7:19185755-19185777 CCTATTCCAAAAAATGAAGGAGG + Intergenic
1021689219 7:23215912-23215934 CCATTACTTAATTAAGAAGGTGG + Intergenic
1021762231 7:23913268-23913290 CCAAGGCCACATAGAGAAGGGGG - Intergenic
1022596995 7:31722217-31722239 GCAATAGCAACTAAAGATGGGGG - Intergenic
1027702100 7:81481996-81482018 ACAACACCAAATAAAGCAAGAGG - Intergenic
1028916216 7:96262302-96262324 CTAACACCAAACAAAGAAAGAGG + Intronic
1029491315 7:100871822-100871844 ACAATAACAAAGAACGAAGGAGG - Intronic
1030714273 7:112790210-112790232 CCAAAACCAAACCAAAAAGGAGG + Exonic
1031467973 7:122136874-122136896 CCTATCCCAGACAAAGAAGGTGG - Intronic
1032276240 7:130458231-130458253 CCCATACAAAAGAAAGAAGTTGG - Intergenic
1032363584 7:131278336-131278358 ACAATAAAAAATAAATAAGGTGG - Intronic
1033664412 7:143427227-143427249 AAAATAATAAATAAAGAAGGAGG - Intergenic
1033885487 7:145939751-145939773 CCAATAACAAATAAAGAAATTGG + Intergenic
1034180129 7:149130618-149130640 AAAATACCAAATAAAGAACGTGG - Intronic
1035594579 8:845855-845877 CAAATGCCAAAGAAAGAAGTTGG - Intergenic
1037751163 8:21683297-21683319 CCAATGCCCAAAAAGGAAGGAGG + Intergenic
1039175087 8:34794380-34794402 CCAATTCCAAACAAAGGAAGGGG + Intergenic
1041318561 8:56590179-56590201 CCAATATAAAATAAATAAGCAGG - Intergenic
1041900827 8:62980091-62980113 CCAAGAGTAAAGAAAGAAGGTGG - Exonic
1042954546 8:74235325-74235347 CCAATATGGAATAAAGAAGAAGG - Exonic
1043618572 8:82159162-82159184 CCTATTTCAAGTAAAGAAGGCGG - Intergenic
1044443420 8:92246195-92246217 CCATTACCAAAAAAAAAAGGTGG - Intergenic
1045830342 8:106452587-106452609 CCAATATCAAATAGAGCAGGTGG - Intronic
1046178758 8:110614430-110614452 TCAATACCAAATAAACAAAAGGG + Intergenic
1046989364 8:120433258-120433280 AGAACAGCAAATAAAGAAGGTGG + Intronic
1046995292 8:120513243-120513265 CCAATACCAATTAAGGCAGAAGG - Intronic
1047524739 8:125623153-125623175 CCAATATGAAATGAAGAAGATGG - Intergenic
1047800032 8:128299339-128299361 ACAATAGTCAATAAAGAAGGCGG + Intergenic
1048667264 8:136676599-136676621 CCACTACCAAATTAAAAAGAAGG + Intergenic
1048949176 8:139479434-139479456 CAAATACAAAATAATGAAGGTGG + Intergenic
1049640995 8:143716038-143716060 CCAATAGCAAAAAGTGAAGGGGG - Intergenic
1049955485 9:689081-689103 CCAATACCAAATGAATTGGGGGG - Intronic
1057043170 9:91862323-91862345 CCATCACCAAAAAAAAAAGGAGG + Intronic
1057229665 9:93312682-93312704 CACATACCAGAAAAAGAAGGTGG - Intronic
1058600574 9:106665515-106665537 CCAGTGCCAAATAAAGTAGGTGG - Intergenic
1060900663 9:127254806-127254828 CCAATAACATACAAAAAAGGAGG + Intronic
1186096507 X:6108375-6108397 CACATACCAAATAAAAATGGTGG + Intronic
1186622121 X:11252469-11252491 CCAATACCAGGTAAGGCAGGAGG + Intronic
1188365286 X:29308206-29308228 CCAACACCAAGGAAAGAAGTGGG - Intronic
1188414940 X:29921370-29921392 CTATTGCCCAATAAAGAAGGGGG - Intronic
1188772688 X:34173702-34173724 ACAATACTGAATAAATAAGGGGG + Intergenic
1192582116 X:72292510-72292532 CCAAAACCAACTAGAAAAGGGGG - Intronic
1192924708 X:75743463-75743485 CCAATACTAGAAAAAGCAGGAGG - Intergenic
1193411149 X:81164666-81164688 GCAGTACCAAACAAAGAAGCTGG + Intronic
1195108967 X:101626173-101626195 CCTTTACCATATAAACAAGGTGG - Exonic
1196422350 X:115536165-115536187 CCAATACAAAATTAATATGGAGG - Intergenic
1197136243 X:123063160-123063182 ACATTTCCAAATAAATAAGGGGG - Intergenic
1197220355 X:123906382-123906404 CCAATAAGAAATATAAAAGGAGG - Intronic
1198652940 X:138883604-138883626 CCAAGACAATAAAAAGAAGGTGG + Intronic
1198683752 X:139206412-139206434 ACAAAACCGAATTAAGAAGGGGG - Intronic
1199116598 X:143999945-143999967 CCATTCCCAAAGAAAGAAGTAGG + Intergenic
1200814517 Y:7517747-7517769 CCAGTACCATAGAAAGATGGAGG + Intergenic
1201611770 Y:15851211-15851233 CCAACACCAAAAAAAAATGGGGG - Intergenic