ID: 1178399556

View in Genome Browser
Species Human (GRCh38)
Location 21:32273522-32273544
Sequence CTGGGGACTAAGACCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178399551_1178399556 16 Left 1178399551 21:32273483-32273505 CCAGAGATTCCAAGCATCTTAGA 0: 1
1: 1
2: 7
3: 29
4: 184
Right 1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG 0: 1
1: 0
2: 0
3: 10
4: 137
1178399552_1178399556 7 Left 1178399552 21:32273492-32273514 CCAAGCATCTTAGAAGCTCTTCT 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178399556 Original CRISPR CTGGGGACTAAGACCAAACA TGG Intronic
900141912 1:1142182-1142204 CTGGGGACTGAGGGCAGACACGG - Intergenic
900846889 1:5111094-5111116 CAGGGGAAGAAAACCAAACAGGG - Intergenic
901382276 1:8882389-8882411 CTGGGGTCAAAGAACATACAGGG - Intergenic
903557743 1:24205913-24205935 GTGGGGACCAAAACCAGACATGG - Intergenic
907194002 1:52671630-52671652 CTGGGAACTGAGACCAATGAGGG + Intergenic
908381791 1:63603804-63603826 GTGGGGACTAAGACTGAGCAGGG + Intronic
920065981 1:203269982-203270004 CTGGGCACTAATAGCAACCATGG + Intronic
922216560 1:223524824-223524846 ATGGAGACAAAGGCCAAACAGGG + Intergenic
923469937 1:234281450-234281472 ATGGGTACAAAGAGCAAACAAGG - Intronic
924647244 1:245889566-245889588 CTTGGGACAGAGACCAGACAAGG - Intronic
1062832835 10:617413-617435 GTGGAGACTGAGACCACACATGG + Intronic
1065346618 10:24754281-24754303 CTGGGAAGTAAGGCAAAACATGG - Intergenic
1066995409 10:42558687-42558709 CTCAGGACTAACATCAAACAGGG + Intergenic
1069751545 10:70748407-70748429 CTGGGGACTGAGAGCGATCAGGG + Intronic
1070745463 10:78931095-78931117 CTGGGGACGAGGACCAGACTTGG + Intergenic
1070954024 10:80453300-80453322 CTGTTGAGTAACACCAAACAGGG - Intergenic
1071417472 10:85454675-85454697 CTGGGAAATAAGACTAGACAAGG - Intergenic
1077528580 11:3083896-3083918 CTGGGGACTGAGACCAGGAAGGG + Intergenic
1080762532 11:35265759-35265781 CTGGGGACAAAGAACAGAAAAGG + Intronic
1082589963 11:54994373-54994395 CTGGGGACAATGTCCAAAAATGG + Intergenic
1082900257 11:58241491-58241513 CTGGGGATTAAGCCCAAACTAGG + Intergenic
1082907869 11:58331443-58331465 CTGGATACTAAAACCAAACAAGG - Intergenic
1083937582 11:65878209-65878231 CTGGTGACCAAGACCAGAGAAGG - Intergenic
1087976606 11:104557154-104557176 CTGGGGACTGAGCTGAAACAGGG - Intergenic
1089040671 11:115446334-115446356 CTGTGGACTCAGACCCAAAAGGG - Intronic
1089392551 11:118111927-118111949 CTGGGGACCAAGGCCAGTCAGGG + Intronic
1090326756 11:125894084-125894106 CTGTGGAATAGGACCAAAGATGG - Exonic
1091188552 11:133669603-133669625 CTGGGGTCTAAGAGCAAGCTGGG + Intergenic
1094768771 12:33628781-33628803 CTGGGCAGTGAGACCAAGCATGG + Intergenic
1099282954 12:80676056-80676078 CTGGGAACTAAGATCAAAGAGGG - Intronic
1099869391 12:88327396-88327418 CTGGGGACTACAACTTAACATGG + Intergenic
1101181623 12:102225248-102225270 CAGGGTACAAAGACAAAACAGGG - Intergenic
1108718583 13:53106526-53106548 TTTGGGAATAAGACCAAGCAAGG + Intergenic
1112455614 13:99559721-99559743 CTGGGGAAGAAGGCTAAACAGGG + Intronic
1113748700 13:112764124-112764146 ATGGGGGCTACGGCCAAACAGGG - Intronic
1116139225 14:40968423-40968445 CTGGGGACAAAGCCCAGACTGGG - Intergenic
1116254997 14:42542199-42542221 CTGGGGACTGAGACAATCCAAGG - Intergenic
1117836605 14:59814241-59814263 CTGGGGAATAAGATCCAGCATGG + Intronic
1120219265 14:81714126-81714148 CTGGGGACAAAGCATAAACAAGG + Intergenic
1122502533 14:102210852-102210874 CGGGGGACGAAGCCCAAACGAGG - Intronic
1124652704 15:31485072-31485094 CTGGGGACCAAGACCAAGTAGGG - Intronic
1124910465 15:33915511-33915533 CTGGGGACCAAGAGCCCACAGGG - Intronic
1126326089 15:47479148-47479170 CTGTTGACCAAGACCAAGCAAGG - Intronic
1126867946 15:52956722-52956744 ATGGGGAATGAGGCCAAACAGGG + Intergenic
1127074615 15:55313205-55313227 CAGGGGATTAAGACCAGACTAGG + Intronic
1128318851 15:66678779-66678801 CTTGGGACCAAGCCCAGACAGGG + Intronic
1128780306 15:70354716-70354738 CTGGGGGCTGAGAGCAGACAGGG - Intergenic
1132070319 15:98770962-98770984 ATGGGGACTAAGACACAACTGGG - Intronic
1133046403 16:3090647-3090669 CTGGGAAACAAGACAAAACAGGG + Intronic
1133732330 16:8588613-8588635 CTGGGTACTAAGAACCAACCAGG + Intronic
1134273130 16:12752015-12752037 CTGGGGAGTCAGACAAAACTGGG - Intronic
1135022701 16:18976294-18976316 CCAGGGATTAAGACTAAACATGG - Intergenic
1139952276 16:70678220-70678242 CTGGGGACTCAGACCCCAGAGGG - Intronic
1141673037 16:85502847-85502869 CTGGGGACCAGGAGCAAGCAGGG + Intergenic
1148195077 17:45707370-45707392 ATGGAGACTGAAACCAAACAGGG - Intergenic
1151217002 17:72583824-72583846 CTGGGGAATAAAACCACAGAAGG + Intergenic
1152046053 17:77936632-77936654 CTGGGGACAAAAAACAAACCTGG - Intergenic
1152073071 17:78143711-78143733 CTGGGGGCCATGACCTAACAAGG + Intergenic
1153267266 18:3283804-3283826 CTGGGAACTAAGACCAGATTTGG - Intergenic
1156882847 18:42101559-42101581 CTGTGGACTGAATCCAAACAAGG + Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161457461 19:4376705-4376727 CTGGTGGCTAAGACCCAGCATGG - Intronic
1164912929 19:32026988-32027010 CTGGGGACCACCACCAACCAGGG - Intergenic
1165059507 19:33198212-33198234 CTGGGGACTAGGGCCAGTCATGG + Intronic
925041618 2:735518-735540 ATGTGGACTAAGACAAGACAGGG + Intergenic
925637077 2:5950961-5950983 CTGGGGGCTACCACCAAACAGGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926121788 2:10245250-10245272 CTGGAGTCTAAGACCCAGCAGGG + Intergenic
926740208 2:16104271-16104293 CAGGGGACTAAGAAAAAAGAAGG + Intergenic
927156973 2:20226060-20226082 CTGGGCCCTGAGACCAAAGATGG + Intergenic
931688977 2:64819084-64819106 CTGGGAACTTAGACAAAACTTGG + Intergenic
932732923 2:74233181-74233203 CTGAGGACCAGGACCAAACTAGG - Intronic
936109277 2:109651684-109651706 CTGGGGACTTAGAACAAAATTGG + Intergenic
944687871 2:202133792-202133814 CAGGAGACTAAGACCCAAGATGG - Intronic
945650174 2:212548292-212548314 TTGCAGAGTAAGACCAAACAGGG - Intergenic
946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG + Intronic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
946358707 2:219206260-219206282 CTGGGACCTAACACGAAACAAGG + Intronic
1169196824 20:3687680-3687702 ATGGGCACTGAGACAAAACATGG + Exonic
1169607675 20:7340600-7340622 CTGGGTACAAAAACCAGACAAGG + Intergenic
1172928532 20:38563850-38563872 CTGGGGACAAAGCCAAAATATGG - Intronic
1173145642 20:40521931-40521953 CTGGGGATTGAGACCAGAGAAGG - Intergenic
1174551303 20:51363566-51363588 CTGGGGAACAAGACCATATAGGG + Intergenic
1175532926 20:59686256-59686278 CTAGGGACCAAGACCACACGTGG - Intronic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1179329479 21:40384785-40384807 ATGGGGAGTGAGACCAAACAAGG - Intronic
1179630093 21:42672418-42672440 ATGGGGACTGAGACCACACTCGG - Intronic
1184825597 22:46948657-46948679 ACGGGGACAAAGACCAAAGAGGG - Intronic
950934240 3:16822495-16822517 CTGGTCACTAAGATCAAAGAAGG + Intronic
953447228 3:42978925-42978947 TTGGGGACTGAACCCAAACAAGG + Intronic
954920758 3:54188895-54188917 CTGGGGACAAACACCACAAATGG - Intronic
957896141 3:86423468-86423490 CGGGGTAATAAGATCAAACAGGG + Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
960625191 3:119675301-119675323 ATGGGGAGTGAGACAAAACACGG + Intronic
963827753 3:149972113-149972135 CTGGGCACTAGGACTAGACATGG + Intronic
966496433 3:180586663-180586685 CTTAGGACTAAAACCAAAAAGGG + Intergenic
967684121 3:192399833-192399855 CTAAGGCCTAAGACCAAACTTGG - Intronic
969578095 4:8048129-8048151 CTGGGGACTGAGCCCAGAGAAGG - Intronic
970182495 4:13414621-13414643 CTTGGTACTAAAACCAGACAAGG + Intronic
972121642 4:35710954-35710976 CTGGACACTTAGACCAAAGAGGG - Intergenic
972880082 4:43411675-43411697 CTGGACACTAAGACCAGACAAGG + Intergenic
974888242 4:67847651-67847673 CTAAGGCATAAGACCAAACAAGG + Intronic
977583513 4:98749374-98749396 CTGGGAACTAATACCACTCAGGG + Intergenic
979798366 4:124875952-124875974 CAGGGGACTGAGTCCAAAAAAGG + Intergenic
981227082 4:142309826-142309848 CTGGAGAGTAATATCAAACAGGG + Intronic
987687492 5:21224495-21224517 CTGGGGACTAACATTCAACATGG - Intergenic
987955001 5:24727781-24727803 CTGGGGAGCAACTCCAAACATGG - Intergenic
988431547 5:31124699-31124721 CTCGGGAGAAAGACCAAAGATGG + Intergenic
989504488 5:42211292-42211314 CTGATTACTAAAACCAAACAAGG - Intergenic
992750051 5:79853376-79853398 CTGGGGACTGAGACCAGAAGGGG + Intergenic
999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG + Intergenic
999865649 5:155697773-155697795 CTGGAGGCCAGGACCAAACAAGG + Intergenic
1004473166 6:15947087-15947109 CTGGTCACTAAGCCCAAGCAGGG - Intergenic
1005299861 6:24459792-24459814 TTTGGGACTAAGTCCAAAGAAGG + Intronic
1006729750 6:36228072-36228094 ATTGGTACTAAAACCAAACAAGG - Intronic
1007761346 6:44135305-44135327 CTGGGGACAGAGAACAGACAGGG - Intronic
1011844048 6:91540065-91540087 ATGGGCAGAAAGACCAAACATGG + Intergenic
1013173189 6:107655807-107655829 CTTTGGACAAAGACCAAACACGG - Intronic
1013368498 6:109451883-109451905 CTGAGGACTTAGAGCAAAGAGGG + Intronic
1015479399 6:133691212-133691234 CAGGAGATCAAGACCAAACATGG + Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1022311832 7:29203785-29203807 TCTGGGACTAAAACCAAACAGGG - Intronic
1023541227 7:41268541-41268563 CTTAGGACTAAGACAAGACAGGG - Intergenic
1024438408 7:49386973-49386995 CTAGGGAAAAAGACCATACATGG - Intergenic
1027624303 7:80528391-80528413 CTGGTGACTGAGACCAACCGGGG - Intronic
1031507121 7:122598922-122598944 CTGGGGACTGAGAACATATAGGG + Intronic
1032195969 7:129788788-129788810 CTGGTGAATAAGACCAAATGAGG - Intergenic
1034882277 7:154771791-154771813 CTACAGACTAAGACCAATCAAGG - Intronic
1038349406 8:26762632-26762654 CACAGGACCAAGACCAAACAGGG + Intronic
1040724434 8:50364379-50364401 CCTGGGACTAAGACCAAATACGG + Intronic
1042566505 8:70117235-70117257 CTGGTGACCCAGACCAATCAAGG - Intronic
1049727715 8:144157498-144157520 CTGGGGAATTCTACCAAACATGG - Intronic
1055671211 9:78607929-78607951 CTCAGGGCTAAGACCAAGCAAGG - Intergenic
1057318558 9:93990103-93990125 CTTGATACTAAAACCAAACAAGG + Intergenic
1059388648 9:113984945-113984967 CTGTGGAGTTAGACCAACCAGGG - Intronic
1059962120 9:119575775-119575797 CAGGGAACTGAGATCAAACATGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061926473 9:133808364-133808386 CTGGGGAGAAAAACCAACCAGGG - Intronic
1062049729 9:134441051-134441073 CCGGGCACGAAGACCAAACCAGG - Intergenic
1062085468 9:134645853-134645875 CTGGGGGCCCAGTCCAAACAGGG + Intronic
1186818619 X:13263378-13263400 ATGGGGACTAAAATCAAAAAGGG - Intergenic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1192366104 X:70474662-70474684 CTGTGGACTAAGGCCTAACCTGG + Intronic
1192921236 X:75708612-75708634 CTGAGAACTAAAACAAAACAAGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1200143707 X:153914733-153914755 CTGGGGTCTGAGACAGAACAGGG + Intronic
1202024139 Y:20502266-20502288 CTGGGAGGTAAGACCAAAAATGG + Intergenic
1202028462 Y:20549451-20549473 CTAGAGACTAAGAAGAAACAAGG - Intergenic