ID: 1178403875

View in Genome Browser
Species Human (GRCh38)
Location 21:32309293-32309315
Sequence ACAGCCCAACATTACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178403872_1178403875 7 Left 1178403872 21:32309263-32309285 CCACGAGTTTTGGTGGGGACAAA 0: 1
1: 4
2: 10
3: 28
4: 154
Right 1178403875 21:32309293-32309315 ACAGCCCAACATTACCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 98
1178403868_1178403875 15 Left 1178403868 21:32309255-32309277 CCAGGTCTCCACGAGTTTTGGTG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1178403875 21:32309293-32309315 ACAGCCCAACATTACCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 98
1178403866_1178403875 27 Left 1178403866 21:32309243-32309265 CCACACTGGGGACCAGGTCTCCA 0: 1
1: 0
2: 2
3: 31
4: 293
Right 1178403875 21:32309293-32309315 ACAGCCCAACATTACCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178403875 Original CRISPR ACAGCCCAACATTACCTTGA AGG Intronic
907708616 1:56854865-56854887 ACCGCACTATATTACCTTGAAGG - Exonic
922634566 1:227154167-227154189 ACAACCTAACATCATCTTGATGG + Intronic
1064441845 10:15360827-15360849 GCAGCCCAACATCACCCTGGCGG + Intronic
1070148908 10:73793580-73793602 ACAGGCAAACAGTACCTGGAAGG - Exonic
1073484348 10:103807223-103807245 ACAGCCCAACCATTCCTAGAAGG + Intronic
1074140254 10:110666304-110666326 ACAGCCCAATATTAAATTTAAGG - Intronic
1076206704 10:128609810-128609832 GCAGCCCACAATTCCCTTGAAGG + Intergenic
1077834488 11:5913190-5913212 ACAGCCTAACATAATATTGAAGG - Intronic
1079634643 11:22720972-22720994 ATAGCCCACCAATGCCTTGAAGG - Intronic
1080896809 11:36454643-36454665 AAAGCACAACAGTACCTTGGAGG - Intronic
1083482850 11:62960794-62960816 ACAGCTCAACCTTCACTTGAAGG + Intronic
1086950538 11:92886158-92886180 ACAACCCAACAATACTTTGGGGG - Intronic
1088064958 11:105706190-105706212 TCAGCACAGCATTGCCTTGAGGG - Intronic
1088471787 11:110194927-110194949 ACAGCACAACATGCTCTTGAAGG + Intronic
1093310509 12:17576567-17576589 CCAGCCCAACATTTCTCTGAAGG + Intergenic
1096924631 12:55129957-55129979 TCATCCCAACATTCCCTAGAAGG - Exonic
1099825526 12:87772429-87772451 ACAGCGCAATATCACCTTGATGG - Intergenic
1100124874 12:91411910-91411932 ACAGGACAACATTACCTGTATGG - Intergenic
1105987560 13:25583393-25583415 ACAGCTCAATTTTAACTTGAGGG - Intronic
1106912638 13:34479208-34479230 ACAGCCCAGCATAACCTGGGAGG - Intergenic
1108786365 13:53907220-53907242 ACTCCCTAACAATACCTTGAAGG + Intergenic
1109017182 13:57031777-57031799 ACAGCCCAATCATAGCTTGAAGG - Intergenic
1116967752 14:51031809-51031831 GCAGGCCAAGGTTACCTTGAAGG + Intronic
1117240176 14:53824291-53824313 ACAGCCAAACATTTGGTTGAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124201927 15:27686198-27686220 TCAGCCCAACACTGCCTTGGTGG - Intergenic
1135938236 16:26798986-26799008 ACAGCCCAGCAATCCATTGATGG + Intergenic
1136287666 16:29253868-29253890 ACAGCCCAACATCAAGGTGAGGG - Intergenic
1141362948 16:83413662-83413684 ACAGCCCTCCCTTACCTTGCCGG + Intronic
1141595377 16:85093971-85093993 ACATCCAGACATTACCTTGTTGG + Exonic
1142093290 16:88226496-88226518 ACAGCCCAACATCAAGGTGAGGG - Intergenic
1144636238 17:16911040-16911062 ACAGCTCAACAGAGCCTTGAAGG + Intergenic
1145282622 17:21478669-21478691 CCAGCCCACCTTTCCCTTGAAGG + Intergenic
1146274067 17:31503736-31503758 ACAGACCAACATGAGCTTCAAGG - Intronic
1158811112 18:61035782-61035804 AAGGCTCACCATTACCTTGAGGG - Intergenic
1160675622 19:389828-389850 ACAGCCCAAGATGCCCTTGGAGG + Intergenic
1163843645 19:19626977-19626999 ACAGCCCGACTTTCACTTGAGGG - Exonic
1166127996 19:40727710-40727732 ACAGCTCAGGACTACCTTGAAGG + Intronic
1167765239 19:51478434-51478456 AGAGCCCAACCTTATCTTTATGG - Intergenic
925247317 2:2395566-2395588 ACACACCAACCTTACCTTTAGGG + Intergenic
925418159 2:3688163-3688185 ATAGCCCAAGATGCCCTTGAGGG + Intronic
925756267 2:7134841-7134863 ACAGCCTAAGATTACCTTTCTGG + Intergenic
928186635 2:29115918-29115940 ACGGCCCAACTTTAGGTTGAGGG + Intronic
937605309 2:123793436-123793458 AAACCCCACCATTACTTTGAGGG + Intergenic
938775842 2:134540486-134540508 ACAACCCAAAATTAACTAGAGGG - Intronic
940926157 2:159365798-159365820 ACAGTCCATCATTATCTTTAAGG - Intronic
941018299 2:160381857-160381879 ACAGCACAGCATTACTGTGAAGG + Intronic
948883767 2:240873042-240873064 AGAGCCCACCCTTACCTTGCCGG - Exonic
1169689238 20:8311815-8311837 ACAGACCAACCTTAACTTTAGGG - Intronic
1174910296 20:54600809-54600831 GCAGGCAAACATTACCTTGCAGG + Intronic
1175895946 20:62335630-62335652 ACACCCCAACATTCCCTCCAGGG + Intronic
1175896097 20:62336143-62336165 GCACCCCAACATTCCCTTCAGGG + Intronic
1176421710 21:6521417-6521439 ACAGCTGAAAATTACATTGATGG + Intergenic
1177215856 21:18127880-18127902 ACAGACCAACATAAACCTGATGG + Intronic
1178403875 21:32309293-32309315 ACAGCCCAACATTACCTTGAAGG + Intronic
1179697200 21:43129733-43129755 ACAGCTGAAAATTACATTGATGG + Intergenic
1181695408 22:24590501-24590523 ACAGCACAACACTACCTCAAGGG - Intronic
950517819 3:13479306-13479328 TCACCCCAACTTTATCTTGAGGG - Intergenic
955735866 3:62037626-62037648 ACAGCCAAACAGTTCCTAGATGG - Intronic
956156460 3:66303477-66303499 ACAGCCTAATCTTACCTGGAAGG - Intronic
956775878 3:72565152-72565174 ACAGGCCTACATTATCTTAAAGG + Intergenic
958777949 3:98508011-98508033 AAATCTCAAAATTACCTTGAAGG + Intronic
962288269 3:134106705-134106727 ACAGCCAAAGTTGACCTTGAAGG - Intronic
962429912 3:135309475-135309497 ACAGGCCAATTTTACCTGGAAGG - Intergenic
962921190 3:139952171-139952193 TCAGCCCAACAGTAACTTCAGGG + Intronic
963248060 3:143081133-143081155 TCAGCCCAATACCACCTTGAGGG - Intergenic
965412024 3:168344104-168344126 ACAGCACAAGATTACTGTGAAGG - Intergenic
966444590 3:179987568-179987590 ACATCAGAACATTCCCTTGATGG + Intronic
967271312 3:187735893-187735915 ATGGCCCAACATGACCTTGTTGG - Intronic
967830999 3:193920192-193920214 CCAGCCCATCATTTCCTTGTAGG - Intergenic
970400390 4:15711882-15711904 TCATCCCAGCATTACCTGGATGG - Exonic
973075884 4:45925118-45925140 ACATGCCAACAGTTCCTTGAGGG - Intergenic
987968983 5:24917454-24917476 ACATGTCAACATTATCTTGAAGG - Intergenic
995391600 5:111646084-111646106 ACAGCCCTACAGCACCTTCAAGG - Intergenic
995558352 5:113354273-113354295 ATAGCCCAACCCTACCCTGAAGG + Intronic
996444481 5:123529592-123529614 GCATCCCAAAATTTCCTTGATGG + Intronic
997817537 5:137033443-137033465 ACAGCCCTGCATTTCCTTGGGGG - Intronic
999227861 5:150042101-150042123 ACAGCCCAAGATTTCATTTAGGG + Intronic
1002632054 5:180588734-180588756 ACAGCCCTTCATGACCTTGGGGG + Intergenic
1008010385 6:46460739-46460761 TCAGCCAAACATTATTTTGAGGG - Intronic
1013857360 6:114590359-114590381 AAAGCCTCACATTACCTAGATGG - Intergenic
1017650838 6:156581142-156581164 ACAGCCCCACATTTTCTTAAAGG + Intergenic
1017822424 6:158059346-158059368 ACAGCCTGGCCTTACCTTGAAGG - Exonic
1020332639 7:7035817-7035839 AGATCCCAAAATTAACTTGATGG - Intergenic
1028880775 7:95877249-95877271 TCAGCCCAACACTAACTTGAGGG + Intronic
1029620051 7:101684757-101684779 ACTGTCCACCATGACCTTGAAGG + Intergenic
1032193019 7:129775173-129775195 TCAGCCCAAGATGACCTTCAAGG + Intergenic
1032444661 7:131972000-131972022 AGAGCCTAAAATTACCTGGATGG + Intergenic
1034258997 7:149742442-149742464 ACTCCCGAACATTACCTTAAGGG + Intergenic
1041607552 8:59800736-59800758 ACTGCTCAGCATTACCTTGAAGG - Intergenic
1041649020 8:60282713-60282735 ACTGGCCAACATTAGCTTGGAGG + Intergenic
1046115610 8:109779823-109779845 CCAGCCAAGCATCACCTTGATGG - Intergenic
1047034210 8:120916670-120916692 ACAGCCCCACATGGGCTTGAAGG - Intergenic
1047860046 8:128955999-128956021 AAGACCCAACATTACTTTGAAGG + Intergenic
1051969313 9:22867487-22867509 AGAGGCCAACAATACCTTAATGG + Intergenic
1052534187 9:29726715-29726737 ACATCCCAACATTGCTTTGTTGG + Intergenic
1057178959 9:93019506-93019528 ACAGCCTGACATCACCTTAAAGG - Intronic
1059618658 9:115978913-115978935 TCAGCCCAAGATTACATGGAAGG + Intergenic
1192298794 X:69879111-69879133 AGAGCTGAACAGTACCTTGAAGG - Intronic
1196076394 X:111581693-111581715 TGAGGCCAACATTACCTTAATGG - Intergenic
1197217956 X:123883925-123883947 ACATTCCAACATTAGCTTCAAGG - Intronic
1200144328 X:153918772-153918794 ACTGCCCACCATTACAGTGAAGG + Intronic