ID: 1178404885

View in Genome Browser
Species Human (GRCh38)
Location 21:32315921-32315943
Sequence CCACCTCCCTGGAGCTCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178404869_1178404885 30 Left 1178404869 21:32315868-32315890 CCCCTGGGCCCCCACATTCCTCT No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404875_1178404885 20 Left 1178404875 21:32315878-32315900 CCCACATTCCTCTGTGAAAGGAC No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404871_1178404885 28 Left 1178404871 21:32315870-32315892 CCTGGGCCCCCACATTCCTCTGT No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404874_1178404885 21 Left 1178404874 21:32315877-32315899 CCCCACATTCCTCTGTGAAAGGA No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404877_1178404885 12 Left 1178404877 21:32315886-32315908 CCTCTGTGAAAGGACAGACCTCT No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404870_1178404885 29 Left 1178404870 21:32315869-32315891 CCCTGGGCCCCCACATTCCTCTG No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404872_1178404885 22 Left 1178404872 21:32315876-32315898 CCCCCACATTCCTCTGTGAAAGG No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404880_1178404885 -6 Left 1178404880 21:32315904-32315926 CCTCTGGGTTACCACACCCACCT No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data
1178404876_1178404885 19 Left 1178404876 21:32315879-32315901 CCACATTCCTCTGTGAAAGGACA No data
Right 1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178404885 Original CRISPR CCACCTCCCTGGAGCTCTAA CGG Intronic