ID: 1178405828

View in Genome Browser
Species Human (GRCh38)
Location 21:32322617-32322639
Sequence GGCCCCAGCAGGACGCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178405824_1178405828 12 Left 1178405824 21:32322582-32322604 CCTCTGAGAACACAGGCAGTCAG 0: 1
1: 0
2: 2
3: 23
4: 301
Right 1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG 0: 1
1: 0
2: 2
3: 27
4: 260
1178405822_1178405828 30 Left 1178405822 21:32322564-32322586 CCTTCAGGTACATGTGCTCCTCT 0: 1
1: 0
2: 0
3: 24
4: 188
Right 1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG 0: 1
1: 0
2: 2
3: 27
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178405828 Original CRISPR GGCCCCAGCAGGACGCCCCC TGG Intronic
900120627 1:1047239-1047261 GGCCCCAGCAGCAAGCCACAAGG - Intronic
900156802 1:1206444-1206466 GTCCCAAGCAGGAGGCGCCCAGG + Exonic
900302632 1:1985739-1985761 GGCCCCTGCATGAAGCCCCTGGG + Intronic
900422988 1:2563629-2563651 GGCCTCAGCAGGACAGGCCCCGG + Exonic
900565052 1:3328049-3328071 GGCCCCAGCCCGAGTCCCCCAGG - Intronic
900880303 1:5376875-5376897 GGCCCCACCATGAGGCCCCTAGG + Intergenic
901199601 1:7459129-7459151 CTCCCCAGCAGGCCACCCCCTGG - Intronic
901332774 1:8423739-8423761 GGCCCCAGCCCCGCGCCCCCCGG - Intronic
901461246 1:9393061-9393083 GGGCACAGCAGGACACCCTCAGG + Intergenic
901500863 1:9651985-9652007 GGTCCCAGCAGCCCGGCCCCCGG - Intronic
901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG + Intergenic
902466927 1:16624223-16624245 GGCCCCAGGAGGACCGCCCAGGG + Intergenic
902507675 1:16948552-16948574 GGCCCCAGGAGGACCCCCCAGGG - Intronic
902955872 1:19923748-19923770 GGCCCCAGCTGGCCCCTCCCCGG - Intergenic
903014965 1:20355730-20355752 GGCTCCAGCAGAACGCCCACTGG + Intergenic
904840322 1:33368299-33368321 GGCCTCAGCAGGCTGCCCTCTGG + Intronic
905792898 1:40799607-40799629 GGCCCTGGCAGCACGCCCACTGG + Intronic
905946307 1:41904214-41904236 GGCAGCAGCAGGAGGGCCCCAGG + Intronic
906118007 1:43368143-43368165 GGTCCCAGCAGGAAGCGCCGCGG + Intergenic
906528894 1:46512078-46512100 GGGCCCAGGAGGCCACCCCCTGG - Exonic
907299955 1:53480851-53480873 GGCCCCAAGAGCCCGCCCCCTGG - Intergenic
909392744 1:75135319-75135341 GGCCTCAGCAGGACGCGCGCGGG + Intronic
911150967 1:94596558-94596580 AGCCCCTGCAGGAGGCCCTCAGG + Intergenic
912576165 1:110674619-110674641 GGCTCCAGCAGGTGGTCCCCGGG + Exonic
919939510 1:202276546-202276568 GCCCCCAGCAGGACCCCACTGGG - Intronic
924560940 1:245156046-245156068 GACCCCAGGAGGAGGCCACCGGG + Intronic
1062956597 10:1544314-1544336 GGCAGCAGCATGAAGCCCCCGGG + Intronic
1067204595 10:44202003-44202025 GGTCCCAGCAGGCCCACCCCAGG - Intergenic
1069623600 10:69852988-69853010 CGCCCCAGCTGGACAGCCCCAGG - Intronic
1069788631 10:71005482-71005504 GGCCCCAGCAGGCCTAGCCCAGG + Intergenic
1069841137 10:71340110-71340132 TGCCCCAGCAGGAGGGCCCTGGG - Intronic
1071302261 10:84264842-84264864 GGCCTCAGCAGGAGACCCCCAGG - Intergenic
1071467068 10:85951009-85951031 GGCCCCTGCAGGACTCCATCTGG + Intronic
1071599946 10:86954172-86954194 GCACCCAGCAGGACTCCCCAAGG - Intronic
1073478556 10:103771082-103771104 GGGCCCAGCAACACGCGCCCAGG + Intronic
1074157708 10:110812715-110812737 AGCAGCAGCAGGATGCCCCCGGG + Exonic
1075902381 10:126053443-126053465 CGCCCCAGCAGAAGGCCACCTGG + Intronic
1076340269 10:129740720-129740742 GGCCCCACCTGCAGGCCCCCAGG + Intronic
1077027691 11:448552-448574 GACCCCAGCTGGACGCGGCCAGG + Intronic
1077027712 11:448602-448624 AGGCCCAACAGCACGCCCCCTGG + Intronic
1077083060 11:734075-734097 GGCCCCGGGAGGAGGACCCCTGG + Intergenic
1077213002 11:1382184-1382206 GGGTGCAGCAGGAAGCCCCCGGG + Intergenic
1077229297 11:1451426-1451448 GGCCCCTGCTGGAGGCCTCCTGG + Intronic
1077251649 11:1563412-1563434 GGTCCCAGCAGACAGCCCCCAGG - Intronic
1077355559 11:2115172-2115194 TGCCCCAGCAGGACCCCATCAGG - Intergenic
1079333565 11:19552438-19552460 GGGCCCAGCAGGACAGGCCCTGG - Intronic
1081672847 11:44951043-44951065 GCCCCCTGCAGGCGGCCCCCGGG - Intronic
1083682779 11:64359028-64359050 GGCCCCAGCCGGCCGCCCACCGG + Intergenic
1083848957 11:65354544-65354566 GGAACCAGCAGGACTCCCCTGGG - Intergenic
1083857136 11:65398811-65398833 GGCTGGAGCAGGACGGCCCCAGG + Intronic
1083876126 11:65525214-65525236 GGCCCGGGCAGGCCGCCCTCTGG - Exonic
1084422632 11:69067977-69067999 AGCTCCAGCAGGACGGCACCAGG - Intronic
1084706892 11:70820825-70820847 GACCCCAGCTGGACTCCACCAGG + Intronic
1085030667 11:73269193-73269215 GTCACCAGCAGGAAGCCCCTGGG - Intronic
1087017414 11:93567469-93567491 GGCCCCAGGAGGACCCGCCAAGG - Intergenic
1088604205 11:111512786-111512808 GGGCCCAGCGGGACCCCCGCCGG - Intergenic
1088893353 11:114060830-114060852 GGACCCAGCCGGTCGCTCCCAGG + Intronic
1089065744 11:115660573-115660595 GGCCCAAGGAGGGCGCCCCCAGG - Intergenic
1089149954 11:116356919-116356941 GGCCCCGGCAGGAATCCTCCAGG - Intergenic
1089321761 11:117631218-117631240 AGCAGCAGCAGGAGGCCCCCAGG - Intronic
1090431906 11:126653327-126653349 GGCACCAGCTGGACCCGCCCAGG + Intronic
1096498279 12:52051083-52051105 GGTCCCAGCTGGGGGCCCCCAGG - Intronic
1096627501 12:52904553-52904575 AGGCCCAGCAGGACGCCAGCTGG + Intronic
1101759324 12:107645969-107645991 CGACCCAGCAGGAGGCTCCCAGG + Intronic
1101807089 12:108073584-108073606 GGCACCTGCAGGACGCTCTCAGG + Intergenic
1103764331 12:123270692-123270714 GGCCGCAGCCGGGCGCTCCCAGG - Intronic
1103842384 12:123875739-123875761 GGCCACATCAGGACTCCCACGGG - Intronic
1104640342 12:130463054-130463076 AGCCCCAGCAGGGACCCCCCTGG - Intronic
1104957702 12:132474484-132474506 GGCCTCTGCTGGACGCCCACCGG - Intergenic
1104958608 12:132477649-132477671 GGCCCCAAAAGGACACACCCAGG - Intergenic
1104986623 12:132601048-132601070 GAGCCCAGCAGGCAGCCCCCAGG - Intergenic
1106846277 13:33741237-33741259 GGCCTCAGAAGGACGCAACCTGG - Intergenic
1111670043 13:91319265-91319287 GGCAGCAGCAGGACACTCCCTGG + Intergenic
1112363946 13:98741234-98741256 GGTCCCAGCAGGAGGACCCCTGG - Intronic
1113728617 13:112624102-112624124 GGCCCCAGCTGGACGACCCGAGG + Intergenic
1113820308 13:113208811-113208833 GGCCCCGGCAGAAAGACCCCGGG - Intronic
1121820062 14:96958849-96958871 GGACCAAGCAGGCTGCCCCCAGG - Intergenic
1122648036 14:103207784-103207806 AGCACCAGCAGGACGGCCCCGGG - Intergenic
1122953896 14:105061101-105061123 GGGCCCAGCAGGAGGCCCGGTGG + Intronic
1122976134 14:105171545-105171567 GGCCCCAGCAGGACATTCACAGG - Intergenic
1125714480 15:41811579-41811601 GAGCCCAGCAGGGGGCCCCCGGG - Intronic
1126113330 15:45187858-45187880 CGCCCCGGCGGGACCCCCCCGGG + Intronic
1126907411 15:53382753-53382775 GGCTCCAGTAGAAAGCCCCCTGG - Intergenic
1127624465 15:60766704-60766726 GGCCCCAGCAAGAAGCTCCTGGG - Intronic
1129200332 15:73994841-73994863 GGCCCCAGCAGGACCCCGCCCGG + Exonic
1129661193 15:77554022-77554044 GGCCCCAGGAGGACAGGCCCAGG - Intergenic
1129663928 15:77568794-77568816 GCCCCCAGCTGGTTGCCCCCAGG + Intergenic
1129834106 15:78691272-78691294 GGCCCCCACAGGACCCTCCCAGG + Intronic
1132750093 16:1453595-1453617 GGCTCCTGGAGGACGGCCCCTGG - Intronic
1132794257 16:1711416-1711438 GGCCTCAGCAGGAAGACCCATGG + Intronic
1132871645 16:2118153-2118175 GGCCCCACCAGGGTGGCCCCTGG + Exonic
1133806396 16:9128639-9128661 GGCACCACCAGGACCCCACCTGG - Intergenic
1134520881 16:14918742-14918764 GGCCCCACCAGGGCGGCCCCTGG - Intronic
1134550694 16:15137231-15137253 GGCCCCACCAGGGGGGCCCCTGG + Intronic
1134708554 16:16317393-16317415 GGCCCCACCAGGGGGGCCCCTGG - Intergenic
1134715769 16:16357426-16357448 GGCCCCACCAGGGTGGCCCCTGG - Intergenic
1134951048 16:18351252-18351274 GGCCCCACCAGGGTGGCCCCTGG + Intergenic
1134958988 16:18394733-18394755 GGCCCCACCAGGGTGGCCCCTGG + Intergenic
1137054002 16:35734840-35734862 GGCCCCCACAGGAAGGCCCCAGG - Intergenic
1137582905 16:49644888-49644910 TGCCCCAGCATGACTCCCACTGG - Intronic
1138550182 16:57743638-57743660 GGCCCCAGCCGGCCTCACCCCGG + Intronic
1138584214 16:57960045-57960067 AGCGCCTCCAGGACGCCCCCAGG - Exonic
1141005209 16:80345781-80345803 GGCCCCAGCAGAAAGCACACTGG + Intergenic
1142242415 16:88953578-88953600 GTCCCCAGCCGGGAGCCCCCAGG - Intronic
1142518515 17:489534-489556 GGGGCCAGCAGGACGCCTCCTGG + Intergenic
1142581690 17:947003-947025 GGCCCCTGGAGGACGCACCGTGG - Intronic
1142596769 17:1033575-1033597 AGCCCAGGCAGGACGCCCCAAGG - Intronic
1143781245 17:9230749-9230771 GGCCCCAGAAGGGCCCTCCCTGG + Intronic
1143875526 17:9987938-9987960 AGCCCCAGCAGGAGGCCACTGGG - Intronic
1145271963 17:21409573-21409595 GGCCCCAGCAAGCTGCCCCTGGG - Intronic
1145310171 17:21697038-21697060 GGCCCCAGCAAGCTGCCCCTGGG - Intronic
1145963521 17:28901408-28901430 GGCCCCAGCAGGGCCCCCGCTGG + Intronic
1147787536 17:42990403-42990425 GGCAGCAGCAGAACGCCTCCAGG + Exonic
1148127024 17:45242232-45242254 GGAGGCAGCAGGAGGCCCCCAGG - Intronic
1151188136 17:72378877-72378899 GCCCCCAGCAGGAGTCCTCCAGG - Intergenic
1151617829 17:75225869-75225891 TGACCCATCAGGGCGCCCCCAGG - Intronic
1151780047 17:76239944-76239966 AGACCCGGCAGGACGCCCCTTGG + Intronic
1151972415 17:77465650-77465672 GGACCCAGCTGCAGGCCCCCGGG - Intronic
1152030435 17:77838838-77838860 GGGCCCAGCAGCCAGCCCCCTGG - Intergenic
1152570365 17:81118980-81119002 GCCCCCAGCAGGGCTCCACCTGG + Intronic
1152612801 17:81323813-81323835 GGCCCCGGCAGAAAGCCGCCTGG - Intronic
1158517802 18:58145183-58145205 GGCCCCAGCTGGAAGCCAACTGG + Intronic
1160563408 18:79772609-79772631 GGACCCAGCAGGACAGCACCTGG - Intergenic
1160791628 19:926138-926160 GGCCCGGGCAGGCCGACCCCAGG + Intronic
1160856178 19:1218992-1219014 GGCCCATGCAGGACGGTCCCAGG - Intronic
1160869232 19:1269483-1269505 GGCCGCAGCGGCACGCCCCTGGG + Intronic
1160894561 19:1396487-1396509 GGGGCGAGCAGGACGGCCCCAGG + Intergenic
1160965506 19:1745431-1745453 GGCCCCAGTAGGAGGGTCCCTGG - Intergenic
1160987264 19:1844798-1844820 GGCCCCAGCAGGACAGTCCCAGG - Intronic
1161072354 19:2269288-2269310 GCCCCCAGAAGGACGCGCGCAGG + Intronic
1161084482 19:2328514-2328536 GGCCCGAGCTCCACGCCCCCCGG + Intronic
1161102983 19:2430461-2430483 GGCCCCACCAGGTCGACGCCTGG + Exonic
1161222088 19:3122476-3122498 GGCCCCGGGAGGCGGCCCCCGGG - Exonic
1162744786 19:12792256-12792278 GGGCCCAGCCGGGGGCCCCCCGG - Exonic
1163153349 19:15427619-15427641 GGCGGCAGCAGCACGCCCACAGG + Intronic
1163380961 19:16968312-16968334 GGCCCCAGCAGGAAGAGCCTGGG + Intronic
1164577447 19:29413872-29413894 AGCCCCAGCAGAACTCTCCCCGG + Intergenic
1164833131 19:31338339-31338361 GGCCCCAGCAGACCCCCACCAGG - Intronic
1165136451 19:33672944-33672966 GACCCAGGCAGGACGCGCCCAGG + Intronic
1165744761 19:38224160-38224182 GCCCCCAGCAGGTCCCCGCCGGG + Exonic
1166765975 19:45252149-45252171 TGCCCCTCCAGGACGCACCCAGG + Intronic
1167503766 19:49861060-49861082 GGTCCCAGCTGGACTCCCCTCGG + Intergenic
1167621952 19:50565720-50565742 GGCCCCAGCAGGCACCCCGCGGG + Intronic
926304319 2:11627108-11627130 GGCCCCAGCAGTTCCCCACCAGG + Intronic
927053085 2:19348946-19348968 GGCCCCAGCTGAACTCCACCTGG + Intergenic
927499916 2:23575790-23575812 GGCCCCAGCAGCTCACCCACCGG + Intronic
930634287 2:53787282-53787304 GGCCGCCGCCGGACGCCTCCAGG - Exonic
932288887 2:70558616-70558638 TGCCCCAGCAGGAGTGCCCCTGG + Intergenic
934503036 2:94873908-94873930 GTCCCCAGCAGGGCCCTCCCTGG + Intronic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
934563699 2:95326833-95326855 GGCCCCAGTAGGCCTCCGCCTGG + Intronic
934856385 2:97732822-97732844 GGGCACAGCAGGAGGCCCCCAGG + Intronic
936017799 2:108972786-108972808 CGCCCCTGCCGGAGGCCCCCCGG - Intronic
936072541 2:109380879-109380901 GGCCCCAGCAGGGCACGCACTGG + Intronic
936376509 2:111945838-111945860 GCCCCCAGAGGGAAGCCCCCAGG - Intronic
938291804 2:130154587-130154609 GGCCTCAGGAGGACACCCCTGGG - Intronic
938464744 2:131518377-131518399 GGCCTCAGGAGGACACCCCTGGG + Intergenic
947720867 2:232368485-232368507 GGTCCCTGCAGGAGGACCCCAGG - Intergenic
948444286 2:238020047-238020069 GTCCCCAGCAGGGCGTCTCCAGG + Intronic
948461145 2:238130582-238130604 GGCCCCTGCAGGACACCTGCAGG + Exonic
948488134 2:238294201-238294223 GGCCCCTGCAGCAGGCTCCCTGG + Intergenic
948868045 2:240785214-240785236 AGGCCCAGCAGGGCGGCCCCTGG - Intronic
1168772574 20:424729-424751 GGCCCCAGCATAATGCCCCTTGG - Intronic
1169216151 20:3795995-3796017 GGCCTCCGCAGGACCCCCCGCGG - Exonic
1170981909 20:21222067-21222089 AGCCCCAGCAGGCTGACCCCTGG - Intronic
1171012709 20:21517245-21517267 TGCCCTCGCAGGACGCCTCCTGG + Intergenic
1171908693 20:30921745-30921767 GGCCCCAGCAGGCCACGCCAGGG - Intergenic
1172202464 20:33136128-33136150 GGCTCCAGCAGGATCCCCTCAGG - Intergenic
1173806211 20:45927041-45927063 GGCCACAGCAGGCAGCCCACAGG + Intergenic
1173834887 20:46118586-46118608 GGCCCCTGTAGGCCGCTCCCGGG - Intronic
1174188060 20:48721013-48721035 GGCCCCAACAGGACACATCCTGG - Intronic
1174201489 20:48809395-48809417 GTTCCCAGAAGGAAGCCCCCAGG - Intronic
1175220852 20:57415519-57415541 GGAGCCAGCAGGAGGCACCCGGG - Intergenic
1175521106 20:59603585-59603607 GTCCCCAGCAGGAGGACCCTTGG + Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175912457 20:62411312-62411334 GGCCTCAGCAGGCCTGCCCCCGG + Intronic
1175921196 20:62451282-62451304 GGCCCCACCAGGCCTCCCCCAGG - Intergenic
1176065348 20:63191380-63191402 GGCCACAGCAGGAAGCCAGCAGG + Intergenic
1176296661 21:5076735-5076757 GGCCCCAGCAGGGCACCCGGAGG + Intergenic
1176423903 21:6535974-6535996 GGCACCAGCAGGCCGTCACCTGG - Intergenic
1176429153 21:6565244-6565266 GGCACCAGCAGGACGACCACAGG + Intergenic
1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG + Intronic
1179699396 21:43144289-43144311 GGCACCAGCAGGCCGTCACCTGG - Intergenic
1179704643 21:43173560-43173582 GGCACCAGCAGGACGACCACAGG + Intergenic
1179785765 21:43728857-43728879 GGCCCCCGCAGGAAGTTCCCAGG + Intronic
1179787017 21:43735762-43735784 GGCCTGATCAGGAGGCCCCCGGG + Intronic
1179860388 21:44185386-44185408 GGCCCCAGCAGGGCACCCGGAGG - Intergenic
1180695517 22:17749289-17749311 GCCTTCAGCAGGACGCTCCCTGG - Intronic
1180833895 22:18920203-18920225 GGGCCCAGGAGGAAGACCCCTGG + Intronic
1181050080 22:20234276-20234298 GGCAACAGCAGGACTGCCCCAGG + Intergenic
1181065926 22:20306036-20306058 GGGCCCAGGAGGAAGACCCCTGG - Intergenic
1181509295 22:23381867-23381889 GCCCCTGGCAGGACACCCCCAGG + Intergenic
1182347262 22:29674947-29674969 AGCCCCAGCTGGTGGCCCCCAGG - Intronic
1182549046 22:31091252-31091274 GCCCCCAGGAGGAGGGCCCCAGG + Exonic
1183056775 22:35311625-35311647 GGCCCCAGAAGGTCTGCCCCAGG + Intronic
1184091012 22:42293053-42293075 GCTCCCAGCAGGAGGCCTCCTGG + Intronic
1184515055 22:44956717-44956739 GGGCCCAGCAAGAGGTCCCCTGG - Intronic
1184821019 22:46909395-46909417 CGCCCCAGGAGCACGCACCCTGG - Intronic
1184955050 22:47880306-47880328 GGCCCCATCAGGACTCATCCAGG + Intergenic
1185372447 22:50467283-50467305 GGCCCCAGCAGGAGGGCCTGTGG + Intronic
1203283981 22_KI270734v1_random:145501-145523 GGGCCCAGGAGGAAGACCCCTGG + Intergenic
950863858 3:16173708-16173730 GGACCATGCAGGACACCCCCTGG - Intergenic
950869272 3:16214593-16214615 GTCCCCTGCAGGACCCACCCAGG - Intronic
953589965 3:44242027-44242049 GGCCCCAGCGGGCCGGCCCCGGG + Exonic
954176311 3:48848255-48848277 GGCCTGAGCAGGACCCGCCCAGG + Intergenic
954635441 3:52068510-52068532 GGCCCCTGCAGGAGGCCCCCAGG + Intergenic
954690921 3:52395196-52395218 GCCCCCACCAGGAAGCCCACTGG + Intronic
956059408 3:65334453-65334475 GCCCCCAGCTGGACACCCCCAGG - Intergenic
961076983 3:123991826-123991848 GAGCCCTGCCGGACGCCCCCTGG - Intronic
961307593 3:125969474-125969496 GAGCCCTGCCGGACGCCCCCTGG + Intronic
961457074 3:127029581-127029603 GGCCTGGGCAGGACGTCCCCCGG + Intronic
961666852 3:128497963-128497985 GGCCCCAGCCCGGCGACCCCCGG + Intergenic
964558505 3:157967148-157967170 GGCTCCAGAAGGAGGCCCGCTGG - Intergenic
966764522 3:183447896-183447918 GGCTGCAGAAGGACGCCCTCTGG - Intergenic
968084142 3:195867090-195867112 GCCCCCAGCCCCACGCCCCCTGG - Intronic
968655108 4:1775061-1775083 GGCACCAGCAGGCCGGCCCGAGG + Intergenic
968701193 4:2059064-2059086 GAGCCCCGCCGGACGCCCCCGGG + Intergenic
968761312 4:2443878-2443900 GGCCCCAGCAGGCCTCTCCATGG - Intronic
968890844 4:3367638-3367660 GGCCCCAGCAGCAAGTGCCCTGG - Intronic
968902754 4:3439092-3439114 GGGCCCCTGAGGACGCCCCCAGG + Intronic
969343667 4:6558055-6558077 GAGCCCAGCAGGACAGCCCCTGG + Intronic
976199111 4:82561841-82561863 GGGCCGGGCCGGACGCCCCCTGG + Intronic
979999349 4:127470445-127470467 GGCCCCAGCAGGGTCCCCCGAGG + Intergenic
981081941 4:140644887-140644909 GGCGACAGCAGGGAGCCCCCAGG + Intronic
981128390 4:141132545-141132567 CGCCCAAGCAGGACGCCCGCGGG - Exonic
981759076 4:148173715-148173737 GGACCAAGAAGGAAGCCCCCTGG - Intronic
985336888 4:188905553-188905575 GGACCCAGTTGGAAGCCCCCGGG - Intergenic
985786725 5:1899438-1899460 GGCCCCAGGAGCAGGCCCCAGGG - Intergenic
986357170 5:6940091-6940113 GGACCCAGCAGGAGGCCCAGTGG + Intergenic
987088072 5:14487793-14487815 GCGCCCAGCAGGCGGCCCCCCGG + Exonic
992105864 5:73448456-73448478 GCCCCCAGCGTGGCGCCCCCCGG - Intergenic
995067503 5:107878890-107878912 GGCTCCAGCACGACGCCGTCTGG - Intronic
995853409 5:116570367-116570389 GGGCCCAGCAGAACGCCTCAAGG + Intronic
999204207 5:149836620-149836642 GGCCCCAGCAGGGTGCCCCTTGG + Exonic
1001961179 5:175880966-175880988 GTCCCCAGGAGGACGCTTCCTGG + Exonic
1002415835 5:179120621-179120643 GGGCCCAGGGGGTCGCCCCCTGG + Intronic
1002471203 5:179437344-179437366 GGCCCCTGCACGCTGCCCCCAGG + Intergenic
1003049266 6:2765493-2765515 GGAACCAGCAGGACGCTCGCGGG - Exonic
1003279463 6:4679123-4679145 GGCCCCAGGAGGCCCCACCCTGG + Intergenic
1003556029 6:7141126-7141148 GGCCCCCTCGGGCCGCCCCCAGG + Intronic
1006190336 6:32203793-32203815 GGCCACAGCAGGATCACCCCTGG - Exonic
1006365820 6:33614495-33614517 AGTGCCAGCAGAACGCCCCCAGG - Intergenic
1017286774 6:152685347-152685369 AGCCACAGCAGGAAGCCACCTGG - Intergenic
1019414464 7:920911-920933 GGGCCCAGCAGGAAGCCACAGGG - Intronic
1019504558 7:1384252-1384274 TGCCCCAGCCGGACCCGCCCGGG - Intergenic
1019504587 7:1384327-1384349 TGCCCCAGCCGGACCCGCCCGGG - Intergenic
1020136304 7:5590015-5590037 GGGCGCAGCAGGAAGCCCCAGGG + Intergenic
1029116663 7:98241173-98241195 GGTCCCTGCTGGACACCCCCGGG - Exonic
1029359889 7:100081120-100081142 GGCTCCAGCAGGATTACCCCTGG + Intronic
1032019768 7:128400779-128400801 GTCCCCAGCAAGATGCCACCTGG - Intronic
1033145593 7:138868006-138868028 GGCACCTACAGGAGGCCCCCCGG - Exonic
1034335974 7:150323624-150323646 TGGCCCAGCAGGTGGCCCCCCGG - Intronic
1034949619 7:155288171-155288193 GTCCCCAGCAGCACACCCCAGGG + Intergenic
1035212381 7:157337453-157337475 AGCCCCAGCCGGCCGCTCCCAGG - Intronic
1035323998 7:158052953-158052975 GACCCCAGCAGGAGCCCCCGAGG - Intronic
1035412207 7:158654059-158654081 GACCCCAGCTGCACTCCCCCTGG + Intronic
1035661617 8:1352367-1352389 GGCCCCATGAGGAAGCCCCAGGG - Intergenic
1036657001 8:10683239-10683261 GGCCCCAGCAGGAAGGCTCCAGG + Intronic
1036784839 8:11679452-11679474 GGCCCAAGCCTGACGCCGCCTGG - Intronic
1039430454 8:37521445-37521467 GGGCCCTGCAGGGCCCCCCCAGG - Intergenic
1039592122 8:38757577-38757599 GCTCCCAGCCGGACGCCCCTGGG - Intronic
1040896692 8:52375602-52375624 TGCCCCAGCAGAATGCCCCTTGG + Intronic
1042546218 8:69953963-69953985 AGGCCCAGCAGGACCCCCGCGGG + Intergenic
1046191035 8:110794073-110794095 GGCCCCAGCTGGACGCACTCTGG - Intergenic
1049261857 8:141643467-141643489 GGTCCCAGCTGGAAGCTCCCAGG - Intergenic
1049405391 8:142449932-142449954 GGCCTCGCCGGGACGCCCCCTGG - Exonic
1049725232 8:144142699-144142721 TGCTCCAGCAGGTCGCCCCAGGG + Intergenic
1049787107 8:144456259-144456281 GTCCACAGCAGGACGGTCCCTGG + Intronic
1049796861 8:144500981-144501003 GCCCCCAGCAGGCCCCGCCCCGG + Intronic
1056422124 9:86438761-86438783 GGCCCCAGCAACACCCGCCCTGG - Intergenic
1057600175 9:96450604-96450626 GGCGCCTGCAGGCCGCCCCCGGG - Exonic
1059959739 9:119553321-119553343 AGCCCCAGCAGGTCACCACCTGG + Intergenic
1060219952 9:121759249-121759271 GGTCCCAGCAGAAGGACCCCAGG - Intronic
1060278719 9:122201460-122201482 TGCCCCAGCATGACGCCTCTGGG - Intergenic
1060514539 9:124257818-124257840 GGCCCAGGAAGGACGCCGCCGGG + Intronic
1060822967 9:126672014-126672036 GGCCCCAGCAGCCCTGCCCCAGG - Intronic
1061002864 9:127912240-127912262 GACCCCAGCAGGCAGGCCCCAGG + Intronic
1061950314 9:133932358-133932380 GGCCCCAGCACGCCCACCCCGGG + Intronic
1062105092 9:134750878-134750900 GGACCCAGCAGTACTCACCCTGG - Exonic
1062254637 9:135615158-135615180 AGCCCCAGCAGGCCACCCTCTGG - Intergenic
1062396176 9:136353733-136353755 GGCCCAATCTGGACTCCCCCAGG - Intronic
1062601331 9:137319886-137319908 GGCCCTAGCAGGATGCCCTTGGG - Intronic
1185608069 X:1378607-1378629 GGTCCCCCCAGGACGGCCCCCGG + Intronic
1185621793 X:1454228-1454250 GCCCCCAGCACCGCGCCCCCAGG - Intergenic
1185736854 X:2501498-2501520 GCCCCAGCCAGGACGCCCCCAGG + Intronic
1186660440 X:11664192-11664214 GGCCCAAGGAGGAGGCCCCCAGG - Intronic
1189340304 X:40200029-40200051 GGCCCTAGCAGTGCGCACCCTGG + Intergenic
1195282262 X:103347977-103347999 TGCTCCAGCAGGAGGCCTCCTGG - Intergenic
1197958792 X:131981168-131981190 GCCCCCAGCAGGACGCCAGCAGG - Intergenic
1200233784 X:154458696-154458718 GGCCCCATCAGGGCACCCCTCGG - Intronic