ID: 1178405869

View in Genome Browser
Species Human (GRCh38)
Location 21:32322846-32322868
Sequence CTGTGCTGTAGGACGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178405869_1178405879 6 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405879 21:32322875-32322897 AACCAGCCGGTGGGAAGGGTGGG 0: 1
1: 0
2: 0
3: 23
4: 268
1178405869_1178405874 -4 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405874 21:32322865-32322887 ACAGGCTTCAAACCAGCCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1178405869_1178405877 2 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405877 21:32322871-32322893 TTCAAACCAGCCGGTGGGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 108
1178405869_1178405878 5 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405878 21:32322874-32322896 AAACCAGCCGGTGGGAAGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 199
1178405869_1178405875 -3 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405875 21:32322866-32322888 CAGGCTTCAAACCAGCCGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1178405869_1178405873 -7 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405873 21:32322862-32322884 AGCACAGGCTTCAAACCAGCCGG 0: 1
1: 0
2: 0
3: 16
4: 169
1178405869_1178405876 1 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405876 21:32322870-32322892 CTTCAAACCAGCCGGTGGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 97
1178405869_1178405882 12 Left 1178405869 21:32322846-32322868 CCAGCTACCGTCCTACAGCACAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1178405882 21:32322881-32322903 CCGGTGGGAAGGGTGGGACTTGG 0: 1
1: 0
2: 3
3: 39
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178405869 Original CRISPR CTGTGCTGTAGGACGGTAGC TGG (reversed) Intronic
900436295 1:2632838-2632860 TTGTGCTGAAGGAAGGTACCCGG - Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
921017980 1:211209741-211209763 CTGTGCTATAGCACAGTACCTGG - Intergenic
923437267 1:233979197-233979219 CTGTGCTTCAGGAAGGTACCTGG + Intronic
1063115311 10:3068104-3068126 CTGAGCTGTAGGACGGGGCCGGG + Intronic
1067787977 10:49264768-49264790 CTGTTCTGTAGGTCAGAAGCTGG + Intergenic
1069857492 10:71449395-71449417 CTGTGCTGTGGGACGGTTCCAGG + Intronic
1071064512 10:81614629-81614651 CTGTGCTGTAGGCTAGTAGATGG - Intergenic
1071127462 10:82351885-82351907 ATATGCTGGAGGACGGTAGTAGG - Intronic
1072741962 10:97915011-97915033 CAGTGCTGAAGGCCGGTACCTGG + Intronic
1074184783 10:111091487-111091509 CTGTGCTGGAGGTCGACAGCAGG + Intergenic
1076358702 10:129871166-129871188 CTGTGCTGCAGGCCGGGTGCTGG + Intronic
1076569867 10:131425638-131425660 CTCTGCAGTGGGACAGTAGCAGG + Intergenic
1090404786 11:126470049-126470071 CTGTGCAGTAGTATGGTACCAGG + Intronic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1091974225 12:4811570-4811592 ATGTGGTGTAGGAAGGTAGCTGG - Exonic
1092478972 12:8843208-8843230 TTGTGCTGTAGAAGGGTCGCAGG - Exonic
1095860134 12:46907755-46907777 CTGTGCTGTAAGACTGCTGCAGG - Intergenic
1095928460 12:47603120-47603142 CTGACCTGTAGGACAGTAGGAGG - Intergenic
1098373027 12:69780289-69780311 CTCTGCTGTAGGATGGAGGCTGG + Intronic
1119136696 14:72227951-72227973 CTGTTCTGTATGAGGGTACCAGG + Intronic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1127316284 15:57797208-57797230 CTGTGCTGTAGCACAAAAGCAGG + Intergenic
1128451900 15:67810714-67810736 CTGTGGTGTGGGACGGTAGGAGG + Intergenic
1128564558 15:68692051-68692073 CTGAGCTGCAGGAGGGGAGCTGG + Intronic
1128704723 15:69830422-69830444 CTGGGCTGTAGGTAGGTGGCTGG + Intergenic
1132557562 16:579272-579294 CTCAGCTGCAGGACGGGAGCAGG - Intronic
1134156865 16:11851287-11851309 CGGGGCTGTGGGACGGTCGCTGG - Intronic
1135705465 16:24671041-24671063 CAGTGCTGTCGGAGGGTTGCTGG - Intergenic
1142411140 16:89917858-89917880 CTGTGCTGAAGGGTGGAAGCGGG - Exonic
1142950930 17:3479549-3479571 CAGTGCTGTGGGAAGGTAGAAGG - Intronic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1152303027 17:79506529-79506551 CAGTGCTGCAGGAAGGTAGGGGG - Intronic
1152903292 17:82957298-82957320 CTGTGCTGTGGGACAGTACGGGG + Intronic
1154306283 18:13233146-13233168 CTGTCCTGAAGGACGTGAGCGGG + Intronic
1154485036 18:14866460-14866482 CTGAGCTGTAGGAGGGTGGCTGG + Intergenic
1157589817 18:48829583-48829605 CTGTGCTGGAGCACGGAGGCTGG - Intronic
1162910577 19:13845960-13845982 CTTTGCGGTAGGACGGTGCCTGG + Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165528672 19:36378622-36378644 CTGTTCTTTAGGAAGGCAGCGGG - Intronic
926006529 2:9377350-9377372 CTGAGCAGTAGGGAGGTAGCAGG + Intronic
933030444 2:77321996-77322018 CTGAGCTGTAGGAGGGTAAAAGG + Intronic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934856792 2:97734773-97734795 CCGGGCTGTGGGACGGGAGCCGG + Intronic
947974536 2:234354204-234354226 CAGTGCAGTAGGATGGTAGATGG - Intergenic
1171374297 20:24681782-24681804 CTGTGCTGTCGGACGCTCACAGG + Intergenic
1176414436 21:6466885-6466907 CTGAGCTGTAGGATGCAAGCGGG - Intergenic
1176796292 21:13373015-13373037 CTGAGCTGTAGGAGGGTGGCTGG - Intergenic
1178405869 21:32322846-32322868 CTGTGCTGTAGGACGGTAGCTGG - Intronic
1178895186 21:36551711-36551733 CTGTGCTGTAGGATCACAGCAGG + Intronic
1179689934 21:43075207-43075229 CTGAGCTGTAGGATGCAAGCGGG - Intronic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180171795 21:46063180-46063202 CTGCTCTGTAGACCGGTAGCTGG - Intergenic
1180304933 22:11066529-11066551 CTGAGCGGTAGGAGGGTGGCTGG + Intergenic
1182186769 22:28412279-28412301 CTGTTCTGGAGAAGGGTAGCAGG - Intronic
951458553 3:22922132-22922154 CTGTGAATTAGGACGGTACCTGG + Intergenic
956436960 3:69243566-69243588 CTATGTCGTAGGAAGGTAGCTGG + Intronic
961513768 3:127420300-127420322 CTGTCCTGGAGGAAGGTAGAGGG + Intergenic
964635417 3:158852995-158853017 CTGTGCTGAAGTACGATAGAAGG - Intergenic
973918441 4:55660314-55660336 CTGTGCGGTAAGACTGTGGCTGG - Intergenic
974185983 4:58446755-58446777 CGGTGGTGTAGGATGGTAGTAGG + Intergenic
979274818 4:118803363-118803385 ATGTGCTGAAGTACGGTAGTGGG - Intronic
980257697 4:130403226-130403248 CTGCAGTGTAGGAAGGTAGCAGG + Intergenic
983593503 4:169441082-169441104 CTGTGGTGTAGGACTGTATGTGG - Intronic
986445973 5:7821672-7821694 CTGTGCTGGAGGACTTCAGCTGG + Intronic
998099043 5:139416765-139416787 CTGGGCTGGACGAAGGTAGCAGG - Intronic
998211697 5:140204428-140204450 CTGTGCTGTATCACAGCAGCAGG - Intronic
999208772 5:149869679-149869701 CTGTGCTGCAGGAAGGCAGCTGG + Intronic
1001727474 5:173918218-173918240 CTGTGCTGTAGGATGGGACCTGG + Intronic
1001880997 5:175243934-175243956 CTGTGCTGTGGAATGGTTGCAGG - Intergenic
1002323118 5:178387455-178387477 CTGAGCTGCAGGAGGGCAGCAGG - Intronic
1007229305 6:40337351-40337373 CTGTGCTGCAGGAAGGAATCAGG - Intergenic
1018001382 6:159581448-159581470 GTGTGCTGTAGGAGGGGAACGGG + Intergenic
1022046811 7:26628142-26628164 CTGGGCTGCAGCACGGTGGCTGG + Intergenic
1024537609 7:50450782-50450804 CTGTGCTGCAGGCAGGGAGCGGG + Intronic
1025741684 7:64202827-64202849 CAGTGCTGTAGCTCAGTAGCTGG - Intronic
1025746145 7:64244755-64244777 CAGTGCTGTAGCTCAGTAGCTGG - Intronic
1053366732 9:37528093-37528115 CTGTGCTTTAGGAGAATAGCTGG - Intronic
1060937413 9:127523692-127523714 CTGTGCTGCAGGACTGCATCCGG - Exonic