ID: 1178406331

View in Genome Browser
Species Human (GRCh38)
Location 21:32326256-32326278
Sequence CTATCTCGAGAACATCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4116
Summary {0: 1, 1: 0, 2: 15, 3: 591, 4: 3509}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178406331_1178406333 -2 Left 1178406331 21:32326256-32326278 CCACAATGATGTTCTCGAGATAG 0: 1
1: 0
2: 15
3: 591
4: 3509
Right 1178406333 21:32326277-32326299 AGAGTGACCAGTGGCCTAATTGG 0: 1
1: 0
2: 0
3: 11
4: 127
1178406331_1178406334 -1 Left 1178406331 21:32326256-32326278 CCACAATGATGTTCTCGAGATAG 0: 1
1: 0
2: 15
3: 591
4: 3509
Right 1178406334 21:32326278-32326300 GAGTGACCAGTGGCCTAATTGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178406331 Original CRISPR CTATCTCGAGAACATCATTG TGG (reversed) Intronic
Too many off-targets to display for this crispr