ID: 1178406675

View in Genome Browser
Species Human (GRCh38)
Location 21:32329934-32329956
Sequence GATGCTGGCCCCTTCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178406670_1178406675 2 Left 1178406670 21:32329909-32329931 CCATTTACATGAAGTTCAAATAC 0: 1
1: 4
2: 47
3: 212
4: 754
Right 1178406675 21:32329934-32329956 GATGCTGGCCCCTTCTAGGGAGG 0: 1
1: 1
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178406675 Original CRISPR GATGCTGGCCCCTTCTAGGG AGG Intronic
900395077 1:2450154-2450176 GTTGCTGTCCCCTTCTTGGCTGG + Intronic
900460952 1:2801919-2801941 GAGGCTGGCCCCGGCTATGGGGG - Intergenic
903656141 1:24949860-24949882 TATGCTGACCCCTCCTGGGGTGG - Intronic
906777232 1:48540796-48540818 GATGCTGGCCTATTCTAGGGGGG - Intronic
907805804 1:57818378-57818400 GATGCTTGCCCCTTCTAGGGAGG - Intronic
911321449 1:96418087-96418109 AATGCTGGAGCCTTCTAGCGGGG - Intergenic
911801498 1:102144775-102144797 GATGCTGGGGACTACTAGGGTGG - Intergenic
912133905 1:106636138-106636160 GACCCAGGCCCCTTCTAGGCTGG + Intergenic
915605030 1:156945040-156945062 GTTGCTGGCCCTCTCCAGGGCGG + Exonic
923412695 1:233725667-233725689 GATGCTGGCCCCTTCTGCCAAGG - Intergenic
1062854640 10:773852-773874 GGTGGTGGGCCCTGCTAGGGAGG + Intergenic
1067032125 10:42885072-42885094 GATGCTGGGTCCTTTGAGGGTGG - Intergenic
1067671102 10:48322415-48322437 GATGCTATCTCCTTCTAGAGAGG + Intronic
1068954718 10:62812778-62812800 GATGCTGATCCCTTCAAGTGGGG - Exonic
1069648177 10:70019953-70019975 GATGCTGGCACCTGCTCTGGTGG - Intergenic
1069916451 10:71789986-71790008 GAGGCTGGCCGCTCCTCGGGAGG - Intronic
1072298618 10:94037595-94037617 GATGCTGGCCCCTTCCTGCTGGG + Intronic
1072409042 10:95183755-95183777 GCTGCTGCCCCCTGCTGGGGCGG - Intergenic
1072690258 10:97568106-97568128 GATGCTGGCTCCATCCAGGATGG - Exonic
1075256844 10:120932096-120932118 GATGTTGGCCACTCCTAGTGAGG + Intergenic
1076522794 10:131091345-131091367 GCTGCTGGCACCTGTTAGGGCGG - Intergenic
1077225561 11:1437752-1437774 GATGCAGGGCCCTTCCAGGCAGG - Intronic
1079526445 11:21394893-21394915 GATTCTGGCTCCTTCTGGGTAGG - Intronic
1082944481 11:58743103-58743125 GATGATGGCCCCTTTTACTGGGG + Intergenic
1084572293 11:69966870-69966892 GATGCAAGCACCTTCTAGGGTGG + Intergenic
1086047164 11:82546813-82546835 GTTGCTGCCCCATTCAAGGGGGG - Intergenic
1095747620 12:45677159-45677181 AATGCTGGCACCTTCTTAGGTGG + Intergenic
1095825173 12:46523591-46523613 GATGTTGGCCCCTCCCAGGAGGG + Intergenic
1097401341 12:59131703-59131725 GAGGCTGGCGACTTGTAGGGAGG + Intergenic
1102948001 12:117006650-117006672 GAGGCAGGCCCCGTCTATGGAGG + Intronic
1103210189 12:119159954-119159976 GATCCTGGGCCCTTCCAGGATGG - Exonic
1104548865 12:129737515-129737537 GATGCATGCCCTTTCTAGGTGGG - Intronic
1106976714 13:35226314-35226336 GAAGCAGCTCCCTTCTAGGGAGG + Intronic
1110864913 13:80382839-80382861 GATTCTGGCCGCTTCTCAGGTGG + Intergenic
1111271469 13:85892552-85892574 TATGCTGGCCCCTTTTAGCCAGG - Intergenic
1111317111 13:86577613-86577635 GATGTTGGCCCATTGTAGGGTGG + Intergenic
1120138526 14:80900272-80900294 GAAGCAGACCCCTTCTAGAGGGG - Intronic
1121825219 14:97004887-97004909 GATGGTGGCTACTTCTGGGGAGG + Intergenic
1122864341 14:104596768-104596790 GATGCTGCCGGCTCCTAGGGCGG + Intronic
1123036184 14:105472915-105472937 GAGGCAGGCCCCTCCCAGGGTGG - Intergenic
1123092720 14:105748929-105748951 GATGCTGGCACCATGCAGGGTGG + Intergenic
1123448292 15:20345068-20345090 GAGGCTGGGCCCATCTAGCGTGG - Intergenic
1129450446 15:75648322-75648344 GGGGCTGGCCACTTCTGGGGCGG + Exonic
1132142791 15:99408925-99408947 AATGCTGGCCATTTCTGGGGAGG - Intergenic
1132375715 15:101327035-101327057 GTTGCTGGCCAGGTCTAGGGTGG + Intronic
1140037152 16:71380138-71380160 GATGGTGGCACCTTGTAGGGGGG + Intronic
1141364642 16:83431586-83431608 AATGCTGGCATCTTCTGGGGAGG + Intronic
1141379037 16:83558979-83559001 GATGCTGACCCCATTGAGGGAGG - Intronic
1141676739 16:85521760-85521782 GAGGCTGGCCCCTCTCAGGGCGG - Intergenic
1144248796 17:13395061-13395083 GATGCAGGAACCTTCTAGGGCGG - Intergenic
1144513820 17:15901078-15901100 GCTGCAGGCTCCCTCTAGGGAGG + Intergenic
1145974029 17:28973991-28974013 GAGGCTGGCCCTTTCCAGGATGG + Intronic
1147185898 17:38712949-38712971 ATTGGTGGCCCCTTCTAGGCTGG - Intronic
1148699400 17:49578742-49578764 GCTGCTGGCCCCGCCTGGGGAGG + Exonic
1149869531 17:60169435-60169457 GATGCTGCCCCCTCCCAAGGGGG + Intronic
1150375195 17:64675691-64675713 GATGTTAGCCTCTTCTATGGTGG - Intergenic
1150491553 17:65577677-65577699 GAAGCTGGCCCTGTCTAGAGGGG + Intronic
1150598721 17:66630914-66630936 TTTGCTGTCCCCTTCTGGGGAGG + Intronic
1152757593 17:82093409-82093431 GATGCTGGGCCCTGCAAGGAAGG + Exonic
1162935638 19:13980233-13980255 CATCCTGGCTCCTTCTGGGGAGG - Intronic
1163276252 19:16286231-16286253 GATCCTGTTCCCTTCCAGGGAGG + Intergenic
1164388152 19:27794322-27794344 GATGCTGGTCCCTTGAGGGGGGG + Intergenic
1165602233 19:37064629-37064651 GATAGTGGCTTCTTCTAGGGGGG - Intronic
1166381708 19:42358280-42358302 TCTGCTGGCCCCTTCTCAGGGGG + Exonic
1167376722 19:49116217-49116239 GATGAGGGCCCCTTCCAGGTAGG - Intronic
1168296383 19:55379062-55379084 TATGCTGGCCCCTTCTCAGAGGG - Intergenic
924966564 2:81848-81870 GATGCTGTGCCCTTGCAGGGGGG + Intergenic
928180063 2:29062580-29062602 GATACTGACCCCTTCTGTGGTGG + Exonic
929442846 2:41978918-41978940 TCTGCTAGCCACTTCTAGGGTGG - Intergenic
930001886 2:46867129-46867151 AGTGCTGGCACCTTCTTGGGAGG + Intergenic
931451293 2:62369643-62369665 GGTACTGGCCCCTCCCAGGGAGG + Intergenic
933779508 2:85791827-85791849 GAGGCTGGCCCACTCCAGGGAGG - Intergenic
934298610 2:91763021-91763043 GCTGCAGGCCCCTTTTAGAGTGG + Intergenic
934844155 2:97651307-97651329 AATGCTGCCCCCTTCCTGGGAGG + Intergenic
938903956 2:135821338-135821360 TATGCTGTCTCCTTCCAGGGAGG + Intronic
948387678 2:237591669-237591691 CATGCTGGCGGCTTCCAGGGAGG - Intronic
1168902424 20:1376271-1376293 AAAGCTGGCCCCTTGTAGGCTGG + Intronic
1169262387 20:4148602-4148624 GAGGGGGGCCCCTGCTAGGGAGG + Intronic
1173266875 20:41491806-41491828 GAAGCAGGCCGCTCCTAGGGAGG + Exonic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178406675 21:32329934-32329956 GATGCTGGCCCCTTCTAGGGAGG + Intronic
1179616076 21:42584218-42584240 GTTGCTGGCCCCCTCCAAGGGGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1180245870 21:46546820-46546842 GCTGTTGGCCCCTTCTTGGGGGG + Intronic
1180972346 22:19822130-19822152 GGTGCTGCCGCCTTATAGGGTGG - Intronic
1183931761 22:41239547-41239569 GCTGCTGGCCCCGGCTAGGCAGG - Exonic
1185035984 22:48477160-48477182 AGTGCTGGCCCTTTCAAGGGAGG + Intergenic
1185163125 22:49241462-49241484 GATGCTGGCCCCTTCCCAGGAGG + Intergenic
1185163138 22:49241540-49241562 GATGCCGGCTCCTTCTCAGGAGG + Intergenic
1185404727 22:50641386-50641408 CAGGGTGGCCCCTCCTAGGGTGG + Intergenic
951046177 3:18041008-18041030 GATGGTGGCTTCTTCTAGAGTGG - Intronic
952511682 3:34064410-34064432 GATGCTTGCCCCTAATAGGATGG + Intergenic
952637043 3:35545244-35545266 GATGATGGCCCCTTCTGTTGAGG - Intergenic
963298328 3:143572089-143572111 GATGCTGGCTCCTTAGAAGGTGG + Intronic
964304409 3:155325380-155325402 GATGATGGCCCCTTCTATTGGGG + Intergenic
967531069 3:190549460-190549482 GATGATGGCCCCTTCTGCTGGGG - Intronic
968686337 4:1961741-1961763 GTTGCCGGGCCCTTCCAGGGCGG + Intronic
978405411 4:108373387-108373409 GATGATGGCCCCTTCTCAGGGGG - Intergenic
979735919 4:124083959-124083981 AAAGCAGGCCGCTTCTAGGGCGG - Intergenic
986344852 5:6824835-6824857 AATAGTGGCTCCTTCTAGGGAGG - Intergenic
991194145 5:63912091-63912113 GATTTAGGCCCTTTCTAGGGGGG + Intergenic
999874892 5:155793236-155793258 GATGCTGGGGACTACTAGGGAGG + Intergenic
1001228372 5:169964595-169964617 GACCATGGCCCCTTCAAGGGTGG - Intronic
1002446667 5:179294459-179294481 GATCCTGGCACCCCCTAGGGTGG - Intronic
1006186484 6:32184276-32184298 GGTGCAGGCCCCACCTAGGGCGG - Exonic
1011660363 6:89589353-89589375 GGTCCTGGCCCCTCCTAGGAAGG + Intronic
1016368417 6:143343472-143343494 GATGCTGGCGTCTTCCAGGCGGG - Intergenic
1017021058 6:150141143-150141165 GCAGCTGGCCTCTTCTAGCGGGG + Intergenic
1019281670 7:203414-203436 CCTGCTGGCCCCTTCCTGGGTGG + Intronic
1024340133 7:48249384-48249406 GATGCTTTCCCCTTTTAGTGAGG + Intronic
1030305101 7:108009709-108009731 GATCCTGCCACCTTCTTGGGAGG - Intergenic
1034343932 7:150374315-150374337 GTTGCTGGGCCCATCTAGGAGGG - Intronic
1034417516 7:150972840-150972862 TAGGCTGGCCCCTTCTGGAGAGG - Intronic
1036483627 8:9159944-9159966 AGTTCTGGCCCCTTCTTGGGAGG + Intronic
1038639935 8:29315692-29315714 GATGCAGGTCCCTTTAAGGGTGG - Intergenic
1040318139 8:46275719-46275741 GATGCTGGGCCATCCCAGGGAGG - Intergenic
1044400874 8:91770467-91770489 GATGCTGGCACTTGCTAGTGAGG - Intergenic
1045975953 8:108131126-108131148 GATCCTGGCCCATTCTCGGAGGG - Intergenic
1049058081 8:140254602-140254624 GAAGCTGGGCCCTTCCTGGGAGG - Intronic
1049712828 8:144073998-144074020 GATGTCAGCCCCTTCCAGGGAGG + Intergenic
1053000409 9:34574534-34574556 TATTCTGCCCCCTTCTAAGGAGG - Intronic
1056801253 9:89693659-89693681 CATGCTGGCCCCTTGGAGGCTGG - Intergenic
1187023378 X:15407546-15407568 GTTGCTGGTCCTTTCCAGGGTGG - Exonic
1188997331 X:36901975-36901997 GGTGCTGACATCTTCTAGGGAGG + Intergenic
1192560636 X:72125785-72125807 GTTGACTGCCCCTTCTAGGGAGG - Intergenic
1197340653 X:125263051-125263073 TGTGCTGCCCCCGTCTAGGGAGG + Intergenic