ID: 1178407495

View in Genome Browser
Species Human (GRCh38)
Location 21:32336579-32336601
Sequence TCTTTTGGTCAGGTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178407495_1178407501 -10 Left 1178407495 21:32336579-32336601 CCAAAGCCCACCTGACCAAAAGA 0: 1
1: 0
2: 0
3: 19
4: 253
Right 1178407501 21:32336592-32336614 GACCAAAAGACTGGGAGCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178407495 Original CRISPR TCTTTTGGTCAGGTGGGCTT TGG (reversed) Intronic
900794393 1:4699188-4699210 GCTTGGGGTCAGGTGGGTTTGGG - Intronic
901438108 1:9261892-9261914 TCTCGTGGTGAGGTTGGCTTTGG + Intronic
901953422 1:12767074-12767096 CTTTTTGGTCAGGATGGCTTTGG + Intergenic
902383799 1:16065161-16065183 TCTTTTGCCCAGGTGTGCTTGGG - Intronic
905840459 1:41172623-41172645 TTTTTTGCTCAGGTTTGCTTTGG - Intronic
906391983 1:45425830-45425852 TCTTTTCCTCAGGATGGCTTTGG - Intronic
907578010 1:55545984-55546006 TCTTCTGTTCAGGTGGAGTTTGG + Intergenic
909056223 1:70824470-70824492 TCTTTTGATCAGGTCAACTTGGG + Intergenic
909582350 1:77252219-77252241 TCTTTTTCTCAGGTTTGCTTTGG - Intergenic
909972550 1:82007908-82007930 TAGTTTGGTCAGGTGGGATGGGG - Intergenic
910086110 1:83404526-83404548 TGCTTTGCTCAGGTGGGTTTAGG - Intergenic
911093726 1:94038758-94038780 TCTGTAGGTCAGCAGGGCTTTGG + Intronic
911925259 1:103821767-103821789 TCTTTTGCTCAGGATAGCTTTGG - Intergenic
913337993 1:117727577-117727599 TCTTTTCTTCTGCTGGGCTTGGG - Intergenic
918797654 1:188924230-188924252 TCTTTTGCTCAGGACTGCTTTGG - Intergenic
919038042 1:192341386-192341408 GCTTTTGGTCCAGTGGGTTTAGG - Intronic
919993137 1:202722988-202723010 TCCTTAGGAGAGGTGGGCTTTGG - Intergenic
920596300 1:207274186-207274208 TCTTTTGCTCAGGGTGGCTTTGG + Intergenic
922373565 1:224937738-224937760 CTTTTTGCTCAGGAGGGCTTTGG - Intronic
924321036 1:242850611-242850633 TCTTTTGCTTAGGTTTGCTTTGG + Intergenic
924432269 1:244007335-244007357 TCATAAGGTCAGGTGGGCCTAGG + Intergenic
924624097 1:245685934-245685956 TCTGTTGGTCAGCTGACCTTCGG - Exonic
1062917721 10:1254602-1254624 TCTTATGGTCAGGTGAATTTGGG + Intronic
1065171438 10:23034519-23034541 TCTTTTATTCAGGTAGGCGTGGG - Intronic
1066142545 10:32521170-32521192 TCTTTTGCTCAGGATAGCTTTGG + Intronic
1068774961 10:60859317-60859339 TCTTTTGGTTAAGTGGTCATAGG - Intergenic
1069553177 10:69378781-69378803 TTTTTTGGTCAGGTAGAATTGGG + Intronic
1071501581 10:86208018-86208040 TCTTTTGGTCAAGAGCCCTTGGG + Intronic
1072785353 10:98275724-98275746 TCTTTTGGCCAGCTGGTCTCCGG - Intergenic
1072936059 10:99714708-99714730 CCTTTGTGACAGGTGGGCTTGGG - Exonic
1072969196 10:100001884-100001906 GTTTTTGGTCTGTTGGGCTTAGG + Intronic
1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG + Intronic
1073364306 10:102925437-102925459 TCTTATGGTTAGGTGAGTTTAGG + Intronic
1073365469 10:102936747-102936769 TCTTTTGATGTGGTGGGTTTAGG + Intronic
1074470004 10:113718441-113718463 CCTTTTGCTCAGGATGGCTTTGG + Intronic
1076456479 10:130602864-130602886 ACTTTTGCTCAGGATGGCTTTGG + Intergenic
1076939343 10:133591105-133591127 CCTTGTGGGCAGGTGGGCTTTGG - Intergenic
1077173184 11:1177393-1177415 GCGTCTGGTCAGGTGGGCTGGGG + Intronic
1077365805 11:2161131-2161153 CCTTTGCGTCAGGTGGGCTCAGG - Exonic
1077901924 11:6496933-6496955 TCTTTTGGGGAGGTGGGATAGGG + Intronic
1082132159 11:48504302-48504324 TCTTTTGCTCAGGATAGCTTTGG - Intergenic
1082244643 11:49907131-49907153 TCTTTTGCTCAGGATAGCTTTGG + Intergenic
1088568315 11:111196524-111196546 TGTGGTGGTCTGGTGGGCTTTGG + Intergenic
1090200270 11:124849277-124849299 TCTTTTGCTCAGGATTGCTTTGG - Intergenic
1090587373 11:128228640-128228662 TCTTATGCTCAGGAAGGCTTGGG - Intergenic
1092498127 12:9018296-9018318 TTTTTTGCTCAGGATGGCTTTGG - Intergenic
1092773755 12:11922864-11922886 TCCCTGGGTCAGGTGTGCTTTGG - Intergenic
1093324180 12:17753577-17753599 TATTTTGCTCAGGATGGCTTTGG + Intergenic
1094330652 12:29289231-29289253 TTTTTTGCTCAGGTTAGCTTTGG - Intronic
1094419609 12:30256822-30256844 TCATTTTGTGAGGTGGGCTGGGG + Intergenic
1094789524 12:33895479-33895501 TCTTTTCTTCTGCTGGGCTTGGG - Intergenic
1095103303 12:38204387-38204409 TCTCTTGATGAGGTGGGCATGGG + Intergenic
1096259768 12:50083197-50083219 TTTTCTGGTGAGGTGGGTTTGGG + Exonic
1096463450 12:51835447-51835469 CCTTTTGGGCTGGTGGCCTTGGG - Intergenic
1097197874 12:57254138-57254160 TTTTTTGGTCAGGTAGAATTGGG - Exonic
1098296228 12:69006731-69006753 TCTTTTTTTCAGTTTGGCTTTGG + Intergenic
1101921626 12:108937758-108937780 TCTTTTGGTAAATTGGCCTTTGG - Intronic
1102244880 12:111349205-111349227 TCCTTTGGAAAGGTGGGCATGGG + Exonic
1103089759 12:118089511-118089533 TATTTTGGGCAGGTGGACTGAGG + Intronic
1103539974 12:121659244-121659266 TCTGTTGGTCAGGAAGGCTGAGG + Exonic
1105033273 12:132900026-132900048 TTTCTTGGTGAGGTGGGCATCGG - Intronic
1106006612 13:25776049-25776071 TCTTTTGGCCCGGTTGTCTTGGG - Intronic
1107397941 13:40037641-40037663 TCTTTTGGTTAGGATTGCTTTGG + Intergenic
1109567969 13:64143302-64143324 TCTTTTGCTCAGGATAGCTTTGG - Intergenic
1109695715 13:65954258-65954280 TATTTTGGTCAGGAGTGCTGTGG + Intergenic
1109881876 13:68489302-68489324 TCTTTTGCTCAGGATTGCTTTGG - Intergenic
1110228139 13:73141202-73141224 TCTTTTGGCCTGGTGACCTTCGG - Intergenic
1111735121 13:92128386-92128408 TGTTTTGGTCAGTTGGTCTAAGG - Intronic
1114396158 14:22363943-22363965 TCTTTTGGTCAGATGGCCATTGG + Intergenic
1118651985 14:67906481-67906503 TTTTTACATCAGGTGGGCTTTGG + Intronic
1120075843 14:80157454-80157476 TCTTTGGGTCAGGAGAGATTTGG - Intergenic
1120292210 14:82589955-82589977 GCTATTGCTCAGGTGGGCCTGGG + Intergenic
1122251364 14:100442119-100442141 TCTTTTGGAGGGATGGGCTTGGG + Intronic
1123462636 15:20487480-20487502 TTTTTTGCTCAGGATGGCTTTGG + Intergenic
1123655425 15:22512922-22512944 TTTTTTGCTCAGGATGGCTTTGG - Intergenic
1124273322 15:28303500-28303522 TTTTTTGCTCAGGATGGCTTTGG + Intronic
1124309333 15:28608117-28608139 TTTTTTGCTCAGGATGGCTTTGG - Intergenic
1126566176 15:50102208-50102230 TCTTTTCTTCTGCTGGGCTTGGG - Intronic
1127188310 15:56504571-56504593 TCTTTTGATCAGGATTGCTTTGG - Intergenic
1128801598 15:70500582-70500604 TCTTTTGCTTCGGTGGGCCTGGG - Intergenic
1129824968 15:78628928-78628950 TCTGTTGGGCAGGTGGGCAGGGG + Intronic
1131369151 15:91865351-91865373 TCTGTTGGTGAGGTGGACATGGG + Intronic
1131980746 15:97992290-97992312 GCTCAAGGTCAGGTGGGCTTGGG - Intergenic
1134316069 16:13120027-13120049 TCTTAAGGGCAGGTGGGCATGGG + Intronic
1134377591 16:13692291-13692313 CCTTTTGCTCAGGATGGCTTTGG - Intergenic
1134389651 16:13807772-13807794 TCTTTGGCTCAGCTGGGCTGTGG - Intergenic
1135168665 16:20164047-20164069 TATTTTGGGGAGGTGGGATTAGG - Intergenic
1137313749 16:47294309-47294331 GCTTTTGCTCAGGAGTGCTTTGG + Intronic
1139241420 16:65396184-65396206 ACATTTGGTCAGGTGAGCTTGGG + Intergenic
1140621250 16:76735983-76736005 GCTTTTGGGCAGGTGGGAGTTGG - Intergenic
1143330647 17:6132486-6132508 CCTTTTGGTCACTTGGGCTTGGG + Intergenic
1144342184 17:14318969-14318991 TCTTTTGGGGATGTGGGTTTGGG + Intronic
1145928319 17:28664722-28664744 TCTTTTGGTTATGTTAGCTTTGG - Intronic
1149249174 17:54748643-54748665 TCTTTTGGTCAGAATAGCTTTGG + Intergenic
1150246613 17:63680464-63680486 TCTTCTGGTTTGGTGAGCTTAGG + Intronic
1150800722 17:68280329-68280351 TCTTTTTTTCAGGATGGCTTTGG - Intronic
1150842704 17:68623939-68623961 TATTTTGGTGAAGTTGGCTTTGG - Intergenic
1151167161 17:72214384-72214406 CTTTTTGGTCAGGATGGCTTTGG + Intergenic
1151805184 17:76400617-76400639 TCTGGAGGTCAAGTGGGCTTTGG - Intronic
1153421647 18:4913430-4913452 TCTTTTGCTCAGGATGGCTTTGG - Intergenic
1158267394 18:55675270-55675292 TCTTTTGCTCAGGATGGCTTTGG + Intergenic
1159621097 18:70639336-70639358 CTTTTTGCTCAGGTTGGCTTTGG + Intronic
1160026228 18:75218835-75218857 TCTTGTGGTCAGGTAGGGTCTGG - Intronic
1161473511 19:4472751-4472773 TCTTGTGGTCTGGTGGTGTTCGG + Intronic
1163089932 19:15012604-15012626 TCTTTGGGTCTTGGGGGCTTAGG - Intronic
1163332319 19:16648088-16648110 TCTTTTTGTCACTTGTGCTTTGG - Intronic
1166993204 19:46705346-46705368 TCTTTTGGAAAGTTGGGGTTGGG - Intronic
1167675255 19:50879979-50880001 TCTTGTGATCAGGTGGTCTATGG + Exonic
928239694 2:29575819-29575841 TCTTTTGGTCAAGTCTGCTGGGG + Intronic
928903162 2:36343372-36343394 TCTATTGGTCAGTAGGCCTTAGG + Intergenic
929422166 2:41803366-41803388 TTCTTTGGTCAGGTAGGCTTTGG + Intergenic
930347268 2:50199393-50199415 TATTTTGGTGGGGTGGGGTTGGG - Intronic
930579409 2:53192279-53192301 TCACTTAGTCAGGTTGGCTTGGG - Intergenic
930975161 2:57449392-57449414 TCTATTGGACAGGAGGTCTTGGG + Intergenic
935752261 2:106246337-106246359 TCTTTTTCTCAGGTTTGCTTTGG - Intergenic
935912672 2:107913880-107913902 TCTTTTTCTCAGGTTTGCTTTGG - Intergenic
936064534 2:109320350-109320372 CCTGCTGCTCAGGTGGGCTTGGG - Intronic
936145603 2:109978654-109978676 TCTTTTAGTGGGCTGGGCTTAGG + Intergenic
936199083 2:110392824-110392846 TCTTTTAGTGGGCTGGGCTTAGG - Intergenic
936832279 2:116661937-116661959 TCTTTTGCTCAGGATAGCTTTGG - Intergenic
937364101 2:121248580-121248602 CCTTGTGGCCAGGTGGGTTTTGG - Intronic
939219579 2:139284387-139284409 TCTTTTCTTCTGGTGGGTTTAGG - Intergenic
939656836 2:144836580-144836602 TCATTTTCTCAGGTGGGCTATGG + Intergenic
940568238 2:155396725-155396747 GCTTTTTGTCATTTGGGCTTAGG - Intergenic
941363477 2:164581572-164581594 TCATTTGTTCTGGTGGGTTTGGG - Intronic
941749916 2:169124048-169124070 TCTTTTGTTCATTTGGGGTTTGG - Intergenic
942084944 2:172435113-172435135 TATTTGGCTCAGGAGGGCTTAGG - Intronic
942228151 2:173834861-173834883 TCTTTTGTTGGGGTGGGATTGGG - Intergenic
942811095 2:180002131-180002153 TCTTTAGTTCAGATGGCCTTTGG - Intronic
942898376 2:181085729-181085751 CCTTTTGCACAGGTGGCCTTAGG + Intergenic
943331602 2:186566587-186566609 CCTTTTGCTCAGGATGGCTTTGG - Intergenic
943780085 2:191813823-191813845 TCATTTGGTCTGCAGGGCTTTGG + Intergenic
943925519 2:193773528-193773550 TTTTTTGCTCAGGGTGGCTTTGG - Intergenic
943925670 2:193775602-193775624 TTTTTTGCTCAGGGTGGCTTTGG + Intergenic
944930524 2:204514180-204514202 TCTTTGGGTCAGGTGGGGGTTGG - Intergenic
945545368 2:211143875-211143897 TCTTTTCGTCTGCTGGGCTTGGG + Intergenic
1169789806 20:9397866-9397888 TCTGTGGGTCATGTGGGCTTAGG + Intronic
1169942526 20:10952534-10952556 TCTTTTGGTGAAATGGGCTGAGG + Intergenic
1171105863 20:22431818-22431840 TCATTTGGTCAAGTGGGGTTAGG - Intergenic
1171512750 20:25699256-25699278 ACTTTTGTTCAGGATGGCTTTGG + Intergenic
1173095650 20:40025565-40025587 TCTGTTGCTGAGGTTGGCTTTGG - Intergenic
1173146458 20:40528966-40528988 TCCTTTGGTCAGGAGGGATGGGG - Intergenic
1174011919 20:47456504-47456526 TCTTCTGGTGTGGTGGTCTTGGG + Intergenic
1176084631 20:63290346-63290368 GCTTTAGGGCAGGTGGGCTGAGG + Intergenic
1178407495 21:32336579-32336601 TCTTTTGGTCAGGTGGGCTTTGG - Intronic
1183779342 22:39988799-39988821 TCTTCTGGTCTGGTGGCCTAAGG + Intergenic
1184059910 22:42075185-42075207 TCTACTGGTCAGGTGACCTTAGG + Intronic
1184236045 22:43183573-43183595 TCTTCTGGTGAGGGGGGCATTGG - Intronic
1184952391 22:47853209-47853231 TCCCTTTGTCATGTGGGCTTAGG - Intergenic
949828738 3:8191077-8191099 TCTTTTGCTCAGGACAGCTTTGG + Intergenic
950276096 3:11662239-11662261 TCTGAAGGTCTGGTGGGCTTCGG - Intronic
950873946 3:16253297-16253319 TCTGTTGGTCAGCTGGGGGTTGG - Intergenic
951097835 3:18652492-18652514 TCATTTGGTCACTTGGGCTTAGG - Intergenic
951410912 3:22365398-22365420 TGTTCTGGTTAGTTGGGCTTGGG - Intronic
951868831 3:27337489-27337511 TCTTTTGCTCAGGATTGCTTTGG - Intronic
952223987 3:31355157-31355179 TTTTTTGCTCAGGATGGCTTTGG - Intergenic
953185539 3:40634449-40634471 TCTTTTCTTCTGCTGGGCTTGGG - Intergenic
955232695 3:57113066-57113088 CCATTTGTTCAGGTGGGCCTGGG - Intronic
955366798 3:58317639-58317661 ACCTTTGGTGGGGTGGGCTTCGG + Exonic
955749414 3:62172540-62172562 ACATTTGGTCATGTGGGCTGTGG - Intronic
956979179 3:74615810-74615832 TCTTTTGGTCTGGAGTGCTGTGG - Intergenic
958677592 3:97286693-97286715 TCTTTTGCTCAGGATTGCTTTGG + Intronic
958695247 3:97519436-97519458 TCTTTTGCTCAGGATTGCTTTGG + Intronic
959039784 3:101407898-101407920 TCTTTTGTTCTGCTGGGTTTGGG - Intronic
962092172 3:132255856-132255878 TCATTTGGTCAGATAGGTTTGGG - Intronic
962515733 3:136149561-136149583 TCTTTTGGTGGGGTGGGGGTGGG - Exonic
962751259 3:138435866-138435888 TCTTATGATTAGGTGAGCTTGGG + Intronic
963480297 3:145864527-145864549 TCTTTTGTTCAGGTGAGCACAGG - Intergenic
964612222 3:158627049-158627071 TCTTTTGGGGAGGGGGACTTAGG + Intergenic
965296375 3:166952527-166952549 TCTTTTTGTCTGTTGGGTTTGGG + Intergenic
970436034 4:16036559-16036581 TCTTTGTGTCTGGTGAGCTTGGG - Intronic
970444767 4:16114531-16114553 TCTTGTGGTCAGATGGACTGGGG + Intergenic
971475445 4:27067830-27067852 TCTTTTGATTAGCTGGGATTTGG + Intergenic
972097094 4:35361765-35361787 TCTTTTCTTCTGCTGGGCTTGGG + Intergenic
972915388 4:43870892-43870914 TCTTTTGCTCAGGATGGCTTTGG + Intergenic
976304699 4:83548200-83548222 TCTTTTTATCAGCTGTGCTTTGG + Intronic
977367538 4:96089894-96089916 CTTTTTGGTCAGGTTTGCTTTGG - Intergenic
977650696 4:99465253-99465275 TCTTTTGCTCAGGATTGCTTTGG + Intergenic
977813630 4:101387716-101387738 TCTTTTCTTCCGCTGGGCTTGGG + Intergenic
977914886 4:102580435-102580457 TGTTTTGGTCATGTGTGCTAAGG + Intronic
977974358 4:103246479-103246501 TCTTTTGGGAAAGTGGCCTTAGG + Intergenic
978076318 4:104534722-104534744 TTTTTTGGTCAAGATGGCTTCGG - Intergenic
978503316 4:109432497-109432519 TCTTTTGCTCATGTGGGGCTAGG + Intergenic
979757302 4:124357787-124357809 TCTTTTTGTCAGGATGGCTTTGG - Intergenic
980124210 4:128758049-128758071 TCTTTTGGTCATGTGGCATCAGG - Intergenic
981996542 4:150981470-150981492 TCTTTTGCTCAGGATAGCTTTGG - Intronic
983423076 4:167545725-167545747 TCTTTTGCTCAGGATTGCTTTGG + Intergenic
983679775 4:170339894-170339916 TCCCTTGTTCAGGTGTGCTTTGG + Intergenic
986211557 5:5678293-5678315 TGTTTTCATCAGGTGGGCTTGGG + Intergenic
986373236 5:7102107-7102129 TCTGATGATTAGGTGGGCTTAGG + Intergenic
988074540 5:26336126-26336148 GTTCTTGGTCAGGTGGCCTTGGG + Intergenic
989231299 5:39089901-39089923 TCTTTTGCTCAGGATTGCTTTGG - Intergenic
992096409 5:73366873-73366895 TGTGTTGGTCTTGTGGGCTTGGG - Intergenic
992344012 5:75857561-75857583 CCTTTTGCTCAGGATGGCTTTGG + Intergenic
993785378 5:92126728-92126750 TGTTTTGGTCTGCTTGGCTTTGG - Intergenic
995289660 5:110436904-110436926 CCTTTTGCTCAGGATGGCTTTGG + Intronic
995710312 5:115028453-115028475 TCTGTTGGTGAGGTGGGAATGGG + Intergenic
995851005 5:116545590-116545612 TCCTTTGTTCAGGTGTGCTCTGG + Intronic
996958422 5:129213384-129213406 TCTTTTGCTCAGGACTGCTTAGG + Intergenic
996994940 5:129684649-129684671 TCTTGTGGGCAGGTGTACTTTGG - Intronic
997767856 5:136523351-136523373 TCTTGTTGCCAGGTGTGCTTTGG + Intergenic
997785393 5:136706838-136706860 TCTTTTGCTCAGGATTGCTTTGG - Intergenic
998581492 5:143381482-143381504 TTTTTTGTTCAGGATGGCTTTGG - Intronic
999560410 5:152795466-152795488 TATTTTGTTCAGGATGGCTTTGG - Intergenic
1000098269 5:157990050-157990072 TCAGTTGGTCAGGTGGTCTTTGG - Intergenic
1002322408 5:178383577-178383599 TTTCTTGGGGAGGTGGGCTTGGG + Intronic
1004742814 6:18478958-18478980 TGTTTTGGTTATGTAGGCTTTGG + Intergenic
1005800775 6:29421178-29421200 ACTTATGGTCAGTTGGTCTTTGG + Intronic
1006104887 6:31710561-31710583 GCTTGTGGGCAGGTGGGCTGTGG - Exonic
1006887125 6:37391232-37391254 TCAGTTGCTCAGCTGGGCTTTGG + Exonic
1008100566 6:47386070-47386092 CCTTTTGCTCAGGATGGCTTTGG + Intergenic
1009628233 6:66163713-66163735 TCTTTTGGTAAAGTGGATTTAGG + Intergenic
1010549987 6:77210027-77210049 CCTTTTGCTCAGGATGGCTTTGG + Intergenic
1011225431 6:85100007-85100029 TCTTTTGTTCTGCTGGGTTTGGG - Intergenic
1013149781 6:107433309-107433331 CCTTTTGGTCAGGATGGCCTTGG - Intronic
1014481798 6:121948302-121948324 TCTTTTGTTCTGCTGGGTTTGGG + Intergenic
1015090311 6:129348293-129348315 CCTTTTGGTCAGGTGCCATTAGG - Intronic
1019382723 7:733252-733274 TTTTTTGCTCAGGATGGCTTTGG + Intronic
1019877438 7:3826739-3826761 TCTGTTGGTCAGGTGGCCCCAGG - Intronic
1019954076 7:4399245-4399267 TGTTTTCTTCAGGTGGGCATAGG + Intergenic
1020995699 7:15261131-15261153 TCTTTTCTTCTGTTGGGCTTGGG - Intronic
1021210901 7:17851238-17851260 TCTTTTGCTCAGTTTGTCTTTGG - Intronic
1021386269 7:20035085-20035107 TCTTCTGGTCAGGAAGGTTTGGG + Intergenic
1027302990 7:76860994-76861016 TGCTTTGCTCAGGTGGGTTTAGG - Intergenic
1027826491 7:83123162-83123184 CCTTTTGCTCAGGATGGCTTTGG - Intronic
1028177594 7:87675391-87675413 TCTTTTGCTCAGGGTTGCTTTGG - Intronic
1029686620 7:102152983-102153005 TCTCCTGGTCAGTTGTGCTTTGG - Intronic
1030599461 7:111577027-111577049 CCTTTTGCTCAGGAGAGCTTTGG - Intergenic
1030985289 7:116234522-116234544 TCTTTTTAACAGATGGGCTTAGG + Exonic
1031357656 7:120807143-120807165 ACTTTTTGTGATGTGGGCTTTGG - Intronic
1032185050 7:129717563-129717585 TCTTTCCTTCAGGTGTGCTTAGG + Intronic
1033813856 7:145049209-145049231 TCTTTTGCTCAGGATAGCTTTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036566420 8:9942073-9942095 GCTCTTGGTCTGGTGGACTTGGG + Intergenic
1038047330 8:23776644-23776666 TCTGTAAGTCAAGTGGGCTTTGG + Intergenic
1039463979 8:37770179-37770201 TTTTTTGCTCAGGATGGCTTTGG - Intronic
1039811381 8:41052098-41052120 TCTTTTCTTCTGGTGGGTTTGGG - Intergenic
1041255359 8:55975809-55975831 TTTTTTGGTAAGGTGGGGGTGGG + Intronic
1041424412 8:57703930-57703952 TCTTGTTTTCAGGTTGGCTTTGG - Intergenic
1043220988 8:77663451-77663473 TCTTCATGTCAGTTGGGCTTGGG - Intergenic
1044895061 8:96882708-96882730 TCTTCTGGCTAGGAGGGCTTGGG + Intronic
1045711309 8:104987875-104987897 TCTGCTAGTCAGGCGGGCTTTGG + Intronic
1046654311 8:116875640-116875662 TCTTTTGCTCAGGATTGCTTTGG - Intergenic
1047395614 8:124496049-124496071 TCTTTGAGTCAGCTGGGTTTTGG - Intronic
1047672509 8:127163834-127163856 TTTTTTTTTCAGGTGGGGTTGGG - Intergenic
1047747447 8:127855469-127855491 TCCTTTAGTCAGGTGGCTTTGGG + Intergenic
1049137779 8:140920353-140920375 TATTATTGTAAGGTGGGCTTAGG - Intronic
1049368950 8:142254390-142254412 AGTGTTGGCCAGGTGGGCTTGGG - Intronic
1050388125 9:5111596-5111618 TCCCTGGGCCAGGTGGGCTTTGG + Intronic
1050979969 9:11997362-11997384 CCTTTTTGACATGTGGGCTTTGG - Intergenic
1051455563 9:17253221-17253243 TCTTTTGCTCAGGATTGCTTTGG + Intronic
1052966867 9:34346976-34346998 GCTTTTGGCCAGTGGGGCTTGGG + Intergenic
1053028542 9:34753679-34753701 TCTTTTGCTCAGGATAGCTTTGG - Intergenic
1055528099 9:77155684-77155706 CCTTTGGGACAGGTGGTCTTAGG + Intergenic
1055913517 9:81376833-81376855 ACCTGGGGTCAGGTGGGCTTGGG - Intergenic
1056261194 9:84850568-84850590 TCTTGAGGTCATGTGAGCTTTGG - Intronic
1056415464 9:86371431-86371453 TCTTTTGCTCAGGATTGCTTTGG + Intergenic
1056795441 9:89655681-89655703 TGTATAGGTCAGGTGGGCCTTGG + Intergenic
1062010878 9:134266046-134266068 TCTTGAGGACAGGTGGGATTTGG + Intergenic
1062721296 9:138045639-138045661 TCTCATGGCCAGGTGGACTTAGG + Intronic
1185842111 X:3401517-3401539 TAATTTGGTCAGCTGGGCCTTGG + Intergenic
1188659249 X:32737726-32737748 CCTTTTGGTCAGGTGCAATTAGG + Intronic
1190470096 X:50770092-50770114 TCTCTTGGACAGGAAGGCTTTGG - Intronic
1190705741 X:53026664-53026686 TAATTTGGTCAGGAGGGATTTGG + Intergenic
1192931590 X:75812093-75812115 TCTTTTCTTCTGCTGGGCTTGGG - Intergenic
1193149408 X:78109162-78109184 CCTGTTTGTCAGGTGGGCTGGGG + Intronic
1193396934 X:80995970-80995992 TCTTTTGGTCAGGATAGCTTTGG - Intergenic
1194058632 X:89168453-89168475 TCTTTTCTTCTGTTGGGCTTGGG - Intergenic
1196109955 X:111935920-111935942 CCTTTTGCTCAGGATGGCTTTGG + Intronic
1198813437 X:140560527-140560549 TCTTTTGATCAGGATTGCTTTGG + Intergenic
1199296141 X:146161103-146161125 TCTTTTTGTCAGGTTTGCTGGGG + Intergenic
1199547733 X:149024743-149024765 TCTTTTGCTCAGGATTGCTTTGG + Intergenic
1199840724 X:151644975-151644997 TCTTCAGGAGAGGTGGGCTTTGG + Intronic