ID: 1178408858

View in Genome Browser
Species Human (GRCh38)
Location 21:32347616-32347638
Sequence CCTCCAGAACATTGGGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178408858_1178408865 7 Left 1178408858 21:32347616-32347638 CCAGCTGCCCAATGTTCTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 1178408865 21:32347646-32347668 CACTTGCTGCCAGCAGCTGAAGG 0: 1
1: 0
2: 0
3: 24
4: 321
1178408858_1178408868 26 Left 1178408858 21:32347616-32347638 CCAGCTGCCCAATGTTCTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 1178408868 21:32347665-32347687 AAGGACCCCTGCACTAAAGTGGG 0: 1
1: 0
2: 1
3: 4
4: 70
1178408858_1178408869 29 Left 1178408858 21:32347616-32347638 CCAGCTGCCCAATGTTCTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1178408858_1178408867 25 Left 1178408858 21:32347616-32347638 CCAGCTGCCCAATGTTCTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 1178408867 21:32347664-32347686 GAAGGACCCCTGCACTAAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178408858 Original CRISPR CCTCCAGAACATTGGGCAGC TGG (reversed) Exonic
900319812 1:2077099-2077121 CCGCCAGAACAACCGGCAGCAGG - Intronic
907303119 1:53500515-53500537 CCTCCAAACCATGGGGCTGCCGG + Intergenic
907317844 1:53583895-53583917 CCTCCAGCACATTTGCCAGTGGG - Intronic
907909478 1:58814295-58814317 CCTCCAGCACATTGAGCAACCGG + Intergenic
912504522 1:110147081-110147103 CCTGCAGAACATTCAGCAGTTGG - Intergenic
912693736 1:111824349-111824371 AGTCCAGAACTTTGGGCATCTGG - Intronic
912694624 1:111831949-111831971 TCTCCAGAACAATGGGCACAGGG + Intronic
913166589 1:116192759-116192781 CTTCCAGAACATAGTGCACCTGG - Intergenic
915778748 1:158521600-158521622 CCTCCAGTACATTGGGCAGTAGG - Intergenic
917743190 1:177981759-177981781 CCTCCAGTACATTGTCCTGCAGG - Intronic
921463570 1:215458451-215458473 AGTCCAGAACAAAGGGCAGCTGG - Intergenic
922794462 1:228333238-228333260 CCTCCACCACCTGGGGCAGCTGG - Exonic
1067060320 10:43075019-43075041 TATCCAGAACATCAGGCAGCAGG - Intergenic
1067227289 10:44384519-44384541 CCTCCAGCACTGTGCGCAGCAGG + Intronic
1067492256 10:46720997-46721019 ACTCCAGAACACTGGCCAGAGGG + Intergenic
1067602406 10:47619387-47619409 ACTCCAGAACACTGGCCAGAGGG - Intergenic
1068251062 10:54441428-54441450 ACTCCAGAACACTGGCCAGAGGG - Intronic
1068669479 10:59709408-59709430 CCTCTAGGACGCTGGGCAGCAGG + Intronic
1069855162 10:71436157-71436179 CCTCCAAAGCATTCGGAAGCAGG - Intronic
1070858643 10:79630119-79630141 CCTCCAGGACACTTGGCAGCTGG - Intergenic
1071653760 10:87424799-87424821 ACTCCAGAACACTGGCCAGAGGG - Intergenic
1072061776 10:91819942-91819964 ACTCCATTACATTTGGCAGCAGG + Exonic
1074856366 10:117476995-117477017 GCCCCAGAGCATTGAGCAGCGGG - Intergenic
1075951377 10:126480712-126480734 CATGCAGAACATAGGGAAGCAGG - Intronic
1080238522 11:30099616-30099638 CCTCCAGCACAATGGGCAAGAGG + Intergenic
1081885060 11:46488201-46488223 ACTCCAGCACTTTGGGAAGCTGG + Intronic
1083174531 11:60941251-60941273 CCACCACAACATTGGCCAGGAGG + Exonic
1083813198 11:65116993-65117015 CGAACAGCACATTGGGCAGCTGG + Exonic
1084726831 11:70947274-70947296 CTTCCAGAACATTGTGCAGTAGG + Intronic
1084989561 11:72909951-72909973 CCTCCCAGACAATGGGCAGCTGG - Intronic
1086551704 11:88059895-88059917 CATCCAGAGAATTGGGCACCAGG - Intergenic
1090932166 11:131307744-131307766 TCTGCAGAACTTTCGGCAGCTGG + Intergenic
1092728341 12:11506054-11506076 CTGCCAGAAAATGGGGCAGCGGG - Intergenic
1096015371 12:48268381-48268403 CCCCCAGAACACTGGCCAACAGG + Intergenic
1102712966 12:114944299-114944321 ACTCCAGAACATTAGGGAGGAGG + Intergenic
1103745576 12:123120930-123120952 CCTCCAAAACATCCGGCAGCAGG + Intronic
1103933642 12:124463763-124463785 CCTCCCGCACATTAGGCTGCAGG + Intronic
1104293509 12:127490815-127490837 CCTCCAGATCGTTGGGCAAGTGG - Intergenic
1107710317 13:43144851-43144873 CCTCGAGAACATGGGGCTCCTGG + Intergenic
1107786416 13:43962304-43962326 CCTCCAGAACAATGGGAATTAGG + Intergenic
1108524684 13:51276740-51276762 TCTCAAGAAAATTGGGCAACGGG - Intronic
1114653927 14:24304647-24304669 ACTCCAGATCACTGGGTAGCTGG + Intronic
1116873831 14:50092153-50092175 TCTACATAACAATGGGCAGCTGG + Intronic
1122901806 14:104785148-104785170 TCTCCAGCACATTGAGCAGACGG + Intronic
1123021472 14:105399696-105399718 CTTCCAGAACCGTGGGCCGCTGG + Intronic
1128994969 15:72289180-72289202 CCCCCAGACCAATGGCCAGCCGG - Exonic
1132103100 15:99041763-99041785 TTTCCAGAAATTTGGGCAGCTGG - Intergenic
1133414259 16:5594000-5594022 CCTCATGAACAATGGGCAGAAGG - Intergenic
1134793587 16:17013711-17013733 ACTGCAGAACATGAGGCAGCCGG - Intergenic
1135080808 16:19433424-19433446 CCTCCAGGTCATTGTGCTGCAGG - Intronic
1138496562 16:57412593-57412615 CCTCCAAAACATGGCGCAGGTGG - Intronic
1139472753 16:67187047-67187069 CTTGGAGAACATTGAGCAGCTGG - Exonic
1139943881 16:70625315-70625337 CCTCCAGAAAAGTGGGAAGGGGG + Intronic
1141138760 16:81483624-81483646 CCCACAAAACAGTGGGCAGCTGG - Intronic
1141706520 16:85668237-85668259 ACCCCAGCACAATGGGCAGCAGG + Exonic
1141765077 16:86052890-86052912 CATGCAGAGCCTTGGGCAGCCGG + Intergenic
1142711880 17:1727968-1727990 CCTGCAGGACATGGGGCAGCAGG - Exonic
1145010440 17:19364829-19364851 CTTCCAGCACATTGGGCAGGCGG + Intronic
1145720336 17:27065521-27065543 TCTCCAGAAATCTGGGCAGCGGG - Intergenic
1147403330 17:40193810-40193832 CCGCCAGATCCTTGGGCACCTGG + Exonic
1148490917 17:48023721-48023743 CCTCCAGCAGAATGGGCACCGGG - Intergenic
1151595567 17:75076352-75076374 CCTCCAGAACCATGGGCCGGTGG - Intergenic
1155354430 18:24937632-24937654 CCCCCATAACATGGAGCAGCAGG - Intergenic
1156180042 18:34592677-34592699 CCTCCAAAACACTGGCAAGCAGG + Intronic
1156493412 18:37510332-37510354 CCTGCAGCAGATTGGCCAGCTGG - Intronic
1157762806 18:50276631-50276653 CCTCCAGAGGATGGGGCATCGGG - Intronic
1158263883 18:55638916-55638938 GCTCCAGCACGTTGGGAAGCTGG + Intronic
1158925703 18:62256700-62256722 CCACCAGAGCATTGGTCAGGAGG - Intronic
1160984851 19:1833783-1833805 CCTCCACGTCACTGGGCAGCCGG - Intronic
1162341233 19:10092541-10092563 CCTAGAGGACATTGGTCAGCAGG - Exonic
1163222436 19:15931171-15931193 CCTCCAGAAAAGGAGGCAGCGGG + Intronic
1163697790 19:18772705-18772727 CCTCCAGAACACGGGGCTACAGG - Intronic
1166327396 19:42059595-42059617 CCTCCTCAACATGGGGCAGCTGG + Intronic
925233496 2:2256608-2256630 CCTTTAGAACATTGTGCAGAGGG + Intronic
926407608 2:12570936-12570958 CCTCCAGAAAAGTGGGAAGGGGG - Intergenic
928315234 2:30239573-30239595 ATTCCAGAACATTTGGCAGGAGG + Intronic
929613635 2:43290941-43290963 CCCCCAGAACATGGCCCAGCTGG - Intronic
930157951 2:48124890-48124912 CCTTCAGAACATTATGCTGCTGG - Intergenic
934521299 2:95021740-95021762 CCTCCAGAACAGTGAGAAACAGG + Intergenic
935383644 2:102478984-102479006 CCTCCAGAACGATGGGTGGCAGG - Exonic
940341108 2:152582305-152582327 TGTCTAGAACATTTGGCAGCTGG - Intronic
940399599 2:153232776-153232798 CCTCCTCAACATAGGGTAGCTGG - Intergenic
940543287 2:155049670-155049692 ATTCCAGCACCTTGGGCAGCTGG - Intergenic
947312151 2:228816555-228816577 GCTCCAGTACATCTGGCAGCAGG - Intergenic
947666248 2:231907583-231907605 CCTTCAGAACAGTGGGCTCCAGG + Intergenic
947910859 2:233799794-233799816 TCTCCACATCATTGGGCAGTTGG + Exonic
948446854 2:238039829-238039851 CCTCCAGAACATGGAGAGGCAGG + Intronic
1169402244 20:5292761-5292783 CCTGCAGAACATTGTGCTGGAGG + Intergenic
1169669933 20:8086702-8086724 CATCCAGAAAATTGGTGAGCAGG - Intergenic
1175992664 20:62797153-62797175 CAGCCAGAACATCGGGCGGCAGG + Exonic
1178408858 21:32347616-32347638 CCTCCAGAACATTGGGCAGCTGG - Exonic
1178570228 21:33728961-33728983 CCTCCAGCCCAAGGGGCAGCAGG + Intronic
1181053624 22:20249107-20249129 TCTCCAGATAATTAGGCAGCAGG - Intronic
1182442899 22:30374487-30374509 GGTCCAGGACAGTGGGCAGCTGG - Exonic
1184035687 22:41917091-41917113 CCTCCAGGGCAGTGGGCAGAGGG - Intergenic
951744063 3:25957336-25957358 CCTCCAGGACATGAGGAAGCTGG - Intergenic
952784052 3:37134706-37134728 CCTGCAGAACATTGTGCTGGAGG - Intronic
954452408 3:50578888-50578910 CCACCAGGACATGGAGCAGCTGG + Exonic
954716055 3:52527501-52527523 CCCCAAGCACATTGGGCAGTGGG + Intronic
957969048 3:87359889-87359911 CCTCTAGAACAAAGGGCTGCAGG + Intergenic
968075169 3:195812207-195812229 CCACCAGAGCTTTGGGCTGCTGG + Exonic
968502445 4:957186-957208 CCTCCAGAACAATACGCAGAGGG - Intronic
968553100 4:1234063-1234085 GCTCCAGAACAGAGGGGAGCAGG - Intronic
969478868 4:7436372-7436394 CCACCAGGACTTTGGGCACCAGG + Intronic
975115211 4:70672774-70672796 CCTCCAGAAAATTGGAGAGGGGG - Intronic
975950441 4:79763721-79763743 CCTGTAGAACCTTGGGCAGCGGG - Intergenic
976218546 4:82737514-82737536 CCACCAGAAAATGGGGCAGCAGG - Intronic
977936316 4:102809809-102809831 CCTGCAGAACATTGTGCTGGAGG + Exonic
978001283 4:103558299-103558321 CCTCCAGAAAAGTGGGAAGGGGG + Intergenic
983539265 4:168891036-168891058 CCTCCTGAACAATGGCCAGCCGG + Exonic
985582183 5:703951-703973 CCTCCAGAAAAGTGGGAAGGGGG - Intergenic
985878005 5:2614804-2614826 CCTCCCGCACATGGGACAGCAGG + Intergenic
992895798 5:81244147-81244169 CCTCCACAGCATAGGCCAGCAGG + Exonic
996716193 5:126589913-126589935 CTTCCCAGACATTGGGCAGCTGG - Intronic
998123640 5:139600396-139600418 CCTCCAGCACAGTGTTCAGCAGG + Exonic
999263053 5:150249367-150249389 CCTCCACAGTACTGGGCAGCTGG + Intronic
999392749 5:151206070-151206092 CCTCCAGAACTTTTGACAGATGG + Intronic
1000897464 5:166873065-166873087 CCCTCAGACCACTGGGCAGCAGG - Intergenic
1001175070 5:169460824-169460846 CCTCGAGAACATTGGGCCCAGGG + Intergenic
1001993543 5:176135650-176135672 GATCCAGAACATCAGGCAGCAGG + Intergenic
1004203672 6:13572883-13572905 CTTCCAGAGCTTTGGGAAGCTGG + Intergenic
1005393221 6:25355008-25355030 CCTCCAGAATATTTGGAAGAGGG - Intronic
1007032410 6:38640097-38640119 CCTCCAGAACAGGGGGCCCCAGG + Intronic
1007595387 6:43048060-43048082 CCTCCAGAGCCTTGCCCAGCAGG + Intronic
1008525475 6:52403273-52403295 CCTCCAGGATCTTGGGCAGGCGG - Exonic
1010864775 6:80961842-80961864 ACTCCAGAACAGTGTGCAGGAGG + Intergenic
1013421670 6:109972718-109972740 CCTCCAGGACACTGGGCATGTGG - Intergenic
1015182003 6:130370548-130370570 ACTCCAGATCATTGTGCAGAGGG - Intronic
1016854015 6:148648343-148648365 CCTCCAGAATACTGGCCAGTGGG - Intergenic
1019854687 7:3592941-3592963 CTTGCAGGGCATTGGGCAGCTGG + Intronic
1020194002 7:6023002-6023024 CCCCCAAAACCTTAGGCAGCAGG + Exonic
1021765507 7:23944152-23944174 CATCCACAACTTTGGGCACCTGG + Intergenic
1023814382 7:43938455-43938477 CCTGCAGAACACTGGGCAGGAGG - Exonic
1024532534 7:50405726-50405748 CCTCCTGAACATTCTGGAGCTGG + Intergenic
1026163412 7:67889732-67889754 CTTCCCGGACTTTGGGCAGCTGG - Intergenic
1026163450 7:67889923-67889945 CTTCCAGGACTGTGGGCAGCTGG - Intergenic
1026163578 7:67890544-67890566 CTTCCAGGACTGTGGGCAGCCGG - Intergenic
1029561045 7:101303097-101303119 CCTCCAGAGTAGGGGGCAGCGGG + Intergenic
1029561923 7:101308616-101308638 CCTCCAGAATAGGGGGCAGCGGG + Intergenic
1030230334 7:107201960-107201982 CTACCAGAACATGGGGCAGGTGG + Exonic
1030261197 7:107565630-107565652 ACTCCAGAAGCTTGGGCAGGAGG - Intronic
1034536586 7:151729349-151729371 CCAGCAGAACAATGGGCACCAGG + Intronic
1035120013 7:156559237-156559259 CCTTCAGAGCAATGGGCAACTGG + Intergenic
1037513952 8:19610992-19611014 CCTCTAGAGCTTTGAGCAGCGGG + Intronic
1037685205 8:21132842-21132864 CTTCCAGAACATTGGGTCTCAGG - Intergenic
1037884861 8:22590553-22590575 CCTCTAGAACAGTGGGGAGAAGG + Intronic
1040975979 8:53194947-53194969 CGTCCACATCATTGGTCAGCTGG + Intergenic
1044921816 8:97176255-97176277 CCTCCAGAAAAGTGGGAAGGGGG - Intergenic
1045050013 8:98315024-98315046 CCCCCAGAACATTCCGGAGCAGG - Intergenic
1049600792 8:143506673-143506695 CCTCCAGAAAACTCAGCAGCAGG + Intronic
1049808132 8:144550601-144550623 GCTCCAGAACACTGGGCTGTGGG + Intronic
1053419736 9:37969829-37969851 CCTTCCCAACATTGGGCAGGGGG + Intronic
1055839131 9:80481836-80481858 CCTCCAGGACCTTGGTCAGTAGG + Intergenic
1057021960 9:91706429-91706451 CCTCCAGAAAATTGGGCAGTAGG + Intronic
1060225973 9:121791127-121791149 CCTCCAGAAAAGTGGGAAGAGGG - Intergenic
1061504424 9:131023515-131023537 GCTCCACATCATTGGCCAGCAGG - Intronic
1061902104 9:133678212-133678234 CCTCCACCACAGTGGCCAGCAGG + Intronic
1185734851 X:2488901-2488923 TCTGCAGCACCTTGGGCAGCAGG + Exonic
1199878801 X:151956421-151956443 CCACCAAAACTTTGGGGAGCAGG - Intronic
1199928640 X:152495602-152495624 CCTCCAGGAAATTGGTCAGTGGG + Intergenic
1200421526 Y:2974650-2974672 CTTCAAGAACATTGGTAAGCTGG + Intronic
1202170009 Y:22033378-22033400 CCTCCAGGACATTTGACTGCAGG + Intergenic
1202221357 Y:22552995-22553017 CCTCCAGGACATTTGACTGCAGG - Intergenic
1202321758 Y:23642667-23642689 CCTCCAGGACATTTGACTGCAGG + Intergenic
1202549009 Y:26027389-26027411 CCTCCAGGACATTTGACTGCAGG - Intergenic