ID: 1178408869

View in Genome Browser
Species Human (GRCh38)
Location 21:32347668-32347690
Sequence GACCCCTGCACTAAAGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178408862_1178408869 22 Left 1178408862 21:32347623-32347645 CCCAATGTTCTGGAGGATCGGGG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1178408857_1178408869 30 Left 1178408857 21:32347615-32347637 CCCAGCTGCCCAATGTTCTGGAG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1178408866_1178408869 -10 Left 1178408866 21:32347655-32347677 CCAGCAGCTGAAGGACCCCTGCA 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1178408858_1178408869 29 Left 1178408858 21:32347616-32347638 CCAGCTGCCCAATGTTCTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 150
Right 1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1178408864_1178408869 21 Left 1178408864 21:32347624-32347646 CCAATGTTCTGGAGGATCGGGGC 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178408869 Original CRISPR GACCCCTGCACTAAAGTGGG TGG Exonic
900176264 1:1292722-1292744 GACCCCTGGACCCAAGGGGGAGG + Exonic
901396085 1:8982853-8982875 AATCCCAGCACCAAAGTGGGAGG + Intergenic
908570359 1:65403540-65403562 GAAACTTGCACTACAGTGGGAGG + Intronic
915890958 1:159773480-159773502 GACTCCAGCACTCATGTGGGGGG - Intergenic
920034597 1:203057819-203057841 GACACCTGAGCTAAAGTGTGAGG + Intronic
922859992 1:228808267-228808289 GACACCTGCCATAATGTGGGTGG + Intergenic
1063146749 10:3301942-3301964 GACCCCCTCACTTATGTGGGGGG + Intergenic
1072802869 10:98405357-98405379 GAGCCCTCAACTAAAGTGAGAGG - Intronic
1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG + Intronic
1075616945 10:123897071-123897093 GACCCCTGGGCCAAAGTGGGTGG - Intronic
1077354606 11:2109300-2109322 CACCGCTGCCCGAAAGTGGGGGG - Intergenic
1082020124 11:47525738-47525760 GACTACTGCACTAAAGCGTGGGG + Intronic
1084488708 11:69465967-69465989 AACCCCTGCTCTGAGGTGGGTGG - Intergenic
1085303137 11:75470118-75470140 GACACCTGCAGCAAAGTGGAAGG + Intronic
1086937840 11:92764083-92764105 GAACCCTGGACTCAAATGGGAGG - Intronic
1088075658 11:105845439-105845461 GACCCCTGCAGTTCAGTGGGAGG + Intronic
1102172370 12:110852160-110852182 GACTCCTGCTCTAAGATGGGAGG + Intronic
1104822280 12:131684054-131684076 GACTCCAGCACTCATGTGGGGGG + Intergenic
1120982195 14:90300059-90300081 GACCACTGCTCTAAAGTGTTGGG - Intronic
1122256591 14:100482675-100482697 GAGCCCTTCACTAATGTGTGGGG + Intronic
1130353169 15:83108552-83108574 GATCCCTGCAGTGGAGTGGGAGG - Intronic
1138511819 16:57513111-57513133 GAGCTCTGAACTGAAGTGGGTGG + Intronic
1141928515 16:87184939-87184961 CACCCCTGCACTCCAGTGTGAGG + Intronic
1143204911 17:5134677-5134699 GATGCCTGCACGAACGTGGGTGG + Intronic
1146171359 17:30636371-30636393 GAAACCTGCTCTAAAGTGGCAGG - Intergenic
1146222397 17:31035935-31035957 GAAACCTGCTCTAAAGTGGCAGG + Intergenic
1146344819 17:32052395-32052417 GAAACCTGCTCTAAAGTGGCAGG - Intronic
1153762150 18:8341685-8341707 GACCCCTGAATCAAAGGGGGGGG - Intronic
1153907292 18:9673447-9673469 GACCCCTGCACAGAGGTGAGTGG - Intergenic
1155359169 18:24982950-24982972 GACCCCTGCCCTAAACTCGGAGG - Intergenic
1156880532 18:42072571-42072593 TACCACTGCACTCCAGTGGGGGG - Intronic
1158893631 18:61894450-61894472 GACTCCGGCACCAAAGGGGGTGG + Intergenic
1162020342 19:7865347-7865369 GAAGCCTGCACTAATGTGGTAGG + Intergenic
1165142850 19:33712804-33712826 GATCCCAGCACCAAAGTTGGGGG - Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925705189 2:6677808-6677830 GACCTCTGCACTATTGGGGGTGG + Intergenic
932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG + Intronic
935371533 2:102351986-102352008 TGCCCCTGCACTGAAGTGTGAGG + Exonic
943561520 2:189469186-189469208 GAATGCTGCACTAAAGTGAGAGG - Intronic
1171099454 20:22368875-22368897 CACCCATGCAGTAGAGTGGGGGG - Intergenic
1177223393 21:18222293-18222315 GCTCTCTGCACTAATGTGGGGGG + Intronic
1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG + Exonic
1180898215 22:19352785-19352807 GAAGGCTGCACTCAAGTGGGAGG + Intronic
1183287942 22:36979536-36979558 GAGCCCTGCAGTTCAGTGGGTGG - Intergenic
1184735479 22:46395319-46395341 GGGCCCAGCACTAAAGTGGCAGG - Intronic
954122002 3:48504858-48504880 GACCCCTGCCCCGAAGTGAGGGG - Intergenic
956168729 3:66416110-66416132 TCTCCCTGCACAAAAGTGGGAGG - Intronic
957537233 3:81522386-81522408 GACTTCTGCACTGAACTGGGAGG + Intronic
961959521 3:130840033-130840055 GACACCTGCTGTTAAGTGGGGGG + Intergenic
981182600 4:141763515-141763537 TACCTCTGCACTTATGTGGGTGG - Intergenic
994166712 5:96616465-96616487 GTCCCAGGCACTAAAGTGGATGG - Intronic
999390015 5:151182971-151182993 TACCCCTGCATTAAAATGGTGGG - Exonic
1000480689 5:161769804-161769826 GACCACTACTCTAAAGGGGGAGG - Intergenic
1001027537 5:168236683-168236705 GACCCCTGCCCTAGAGGGGCAGG - Intronic
1001121039 5:168980073-168980095 GTCCCCTGCTCTAAAGTGTGGGG - Intronic
1013288295 6:108698961-108698983 GCCCCCTGGTCTAATGTGGGAGG + Intergenic
1017516240 6:155158284-155158306 GTCTCCTGTAGTAAAGTGGGAGG - Intronic
1023696210 7:42850159-42850181 AATCCCAGCACTAATGTGGGTGG - Intergenic
1026959890 7:74401202-74401224 GAACCCTGATCTAAAGCGGGAGG + Intronic
1037700230 8:21267139-21267161 GAGCCTTGCACTGAGGTGGGGGG - Intergenic
1040078844 8:43267733-43267755 GACCCCTGCACTCCAGTGTGGGG - Intergenic
1041007359 8:53508129-53508151 AACTCCTGGGCTAAAGTGGGTGG - Intergenic
1044028172 8:87199710-87199732 AACCCCTGCTCTAAAATGAGGGG - Intronic
1045879383 8:107020430-107020452 GACACCAGGACTGAAGTGGGAGG + Intergenic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1050163526 9:2741707-2741729 GACCCCTGTACTGAAGAGTGAGG - Intronic
1059264371 9:113012109-113012131 GACCCTTGCACTCGTGTGGGAGG - Intergenic
1059811765 9:117862907-117862929 GAGGCCTGTACTAAGGTGGGTGG - Intergenic
1190119590 X:47649575-47649597 GACTCCTGCACCACAGTGAGAGG + Intronic
1191849173 X:65572922-65572944 GACCCCTGCACTAGAGGGCTGGG - Intergenic
1196179018 X:112670371-112670393 GTTCCCTGCACTAAAGTTAGGGG + Intronic
1196699783 X:118655504-118655526 TATCACTGCACTAAAGTGGCTGG - Intronic