ID: 1178411662

View in Genome Browser
Species Human (GRCh38)
Location 21:32368650-32368672
Sequence GCACGTCACCATGAGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178411662_1178411666 24 Left 1178411662 21:32368650-32368672 CCTGAGAGCTCATGGTGACGTGC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1178411666 21:32368697-32368719 AACACAGCAATAACAACGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 169
1178411662_1178411665 23 Left 1178411662 21:32368650-32368672 CCTGAGAGCTCATGGTGACGTGC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1178411665 21:32368696-32368718 GAACACAGCAATAACAACGTAGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178411662 Original CRISPR GCACGTCACCATGAGCTCTC AGG (reversed) Intronic
915556025 1:156661255-156661277 GCTCACCACCATGGGCTCTCTGG - Intergenic
917475543 1:175366104-175366126 GGCTGTCACCATGAGGTCTCGGG + Exonic
1069410577 10:68149150-68149172 ACAGGTCACCTTGACCTCTCAGG - Intronic
1070536694 10:77384007-77384029 GTGCGTCACCATCAGCTCTCTGG + Intronic
1077601875 11:3580289-3580311 GCACGACACCGGGAGCTCACAGG + Intergenic
1078435765 11:11324026-11324048 GCACACAACAATGAGCTCTCTGG - Intronic
1084425448 11:69081601-69081623 GCCCGTCACCCTGGGCTCCCTGG + Intronic
1089201450 11:116727021-116727043 GAAAGTGACCAGGAGCTCTCTGG + Intergenic
1090269030 11:125372870-125372892 GGACTTGAGCATGAGCTCTCTGG - Intronic
1096693179 12:53333467-53333489 GCACTGCACCATGAGCTCCCTGG - Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101867586 12:108532318-108532340 GGGTGTCACCATGAGCTCTAAGG + Exonic
1104423959 12:128659522-128659544 GCAAGACACCCTGAGCTCTGTGG + Intronic
1107885744 13:44872978-44873000 GCAAGTGACCACGAGCTCTGTGG - Intergenic
1118672466 14:68144187-68144209 GCAAATGACCAAGAGCTCTCTGG - Intronic
1118984608 14:70742671-70742693 CCAGGTCACCATAAGCCCTCTGG - Intronic
1121107731 14:91292115-91292137 TCACCTCACCGTGAGCTCTTGGG - Intronic
1121614727 14:95305735-95305757 GCAGGTCACCTTGAAGTCTCAGG + Intronic
1121700187 14:95947024-95947046 GCACATGGCCATGAGCTTTCAGG - Intergenic
1124781125 15:32635078-32635100 GCAGGTCAACATGAGAACTCTGG - Intronic
1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG + Intergenic
1136764881 16:32768814-32768836 GCACGTGGCCATCAGCTCACAGG - Intergenic
1136776881 16:32876698-32876720 GGACCCCACCAGGAGCTCTCAGG + Intergenic
1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG + Intergenic
1136893736 16:33984815-33984837 GGACCCCACCAGGAGCTCTCAGG - Intergenic
1140219216 16:73031762-73031784 GCAGGTCACCACGGGCCCTCTGG + Intronic
1142408652 16:89905004-89905026 GCCCGCCACCATGAGCTGGCTGG + Exonic
1203067238 16_KI270728v1_random:1030939-1030961 GCACGTGGCCATCAGCTCACAGG - Intergenic
1203079297 16_KI270728v1_random:1138807-1138829 GGACCCCACCAGGAGCTCTCAGG + Intergenic
1144757032 17:17686101-17686123 GCACGTCTCCTTGCTCTCTCCGG + Intronic
1148663649 17:49358151-49358173 ACAAGTCACTTTGAGCTCTCTGG - Intronic
1161331648 19:3691398-3691420 GCACGTCACAGTGTGCTCGCAGG - Intronic
1161756553 19:6138341-6138363 TCACGTGACCAGGACCTCTCAGG + Intronic
1164710896 19:30356575-30356597 GATCTTCACCATGAGATCTCTGG + Intronic
926862580 2:17324497-17324519 GCACATCTCCAAGAGCACTCTGG + Intergenic
934674176 2:96237972-96237994 GCACGTGACCATGGGATCACTGG + Intergenic
938083074 2:128380572-128380594 CCAGGCCACCATCAGCTCTCTGG + Intergenic
948521877 2:238544533-238544555 GCACTTCACCAGGAGGTCTTTGG - Intergenic
948522405 2:238548462-238548484 GCACTTCACCAGGAGGTCTTTGG - Intergenic
1168805268 20:669034-669056 GCAAGTCTCCATGCCCTCTCTGG - Intronic
1169360398 20:4943848-4943870 GCACGTCAGCAGACGCTCTCTGG - Intronic
1174147560 20:48462787-48462809 ACACTCCACAATGAGCTCTCTGG - Intergenic
1174210869 20:48876812-48876834 TCACTTAACCATGAGCTCTTTGG + Intergenic
1178411662 21:32368650-32368672 GCACGTCACCATGAGCTCTCAGG - Intronic
1184498515 22:44857942-44857964 GCAGGTCACCCTCAGCTCTGTGG - Intronic
950196262 3:11011214-11011236 GCAAGCCACCATCATCTCTCTGG + Intronic
953697732 3:45172832-45172854 GCAAGTGACCATGAGGTCCCTGG - Intergenic
958155894 3:89755342-89755364 CCAGGTCTCCATGAACTCTCTGG + Intergenic
967266412 3:187696056-187696078 GAACCTCACCTTCAGCTCTCAGG + Intergenic
969099386 4:4757432-4757454 GCACTTCCCCCTGTGCTCTCAGG + Intergenic
969258725 4:6020764-6020786 GCACCGCACCGTGAGCTCCCAGG + Intergenic
969377069 4:6769863-6769885 GCACATCAGTTTGAGCTCTCTGG - Intergenic
972123723 4:35738623-35738645 CCCAGTCACCATGAGCACTCAGG - Intergenic
973641651 4:52908879-52908901 TCATGTAACCATGAGATCTCTGG - Intronic
977571667 4:98635333-98635355 GCTTGTCACCATGACCTCTTTGG - Intronic
978407677 4:108397068-108397090 GCACCACACCCTGAGCCCTCAGG - Intergenic
984084274 4:175289119-175289141 GCACCTCCCCCAGAGCTCTCAGG + Intergenic
986330295 5:6712829-6712851 GCAGGTCACGCTGCGCTCTCTGG - Intergenic
988971569 5:36473585-36473607 GTATGTCACCATGAGATCTATGG + Intergenic
992396705 5:76375251-76375273 CCAACTCACCCTGAGCTCTCTGG + Intergenic
994075113 5:95641837-95641859 CCACGTCACCTAAAGCTCTCTGG + Intergenic
995412268 5:111872177-111872199 GAACGACACCATCAACTCTCTGG - Intronic
1001963462 5:175894485-175894507 CCCCGTCACCATGTGCTCCCCGG - Intergenic
1003870868 6:10402057-10402079 GCACATAACCCTGAGCTTTCAGG + Intronic
1007094527 6:39205166-39205188 GAATGTCAGCGTGAGCTCTCAGG + Intronic
1015196160 6:130526679-130526701 GAACCTCACCATGAGCTGCCAGG - Intergenic
1018939492 6:168299744-168299766 GCATGTCACCATGTGCTCCGGGG + Intronic
1018961745 6:168454462-168454484 GCACGAAACCCAGAGCTCTCAGG + Intronic
1019027661 6:168983804-168983826 GCACGTCACCATTAGGTCCTGGG - Intergenic
1020123207 7:5517301-5517323 GGACGAAACCATGAGCTCTTTGG - Intergenic
1023138479 7:37077398-37077420 GCACGTCACACTGAGATTTCTGG + Intronic
1023973297 7:45007965-45007987 TGTTGTCACCATGAGCTCTCTGG + Intronic
1030871220 7:114758474-114758496 GCATCTCATCATGGGCTCTCTGG + Intergenic
1036359406 8:8066429-8066451 GCAGGACACCAGGAGCTCACAGG - Intergenic
1039405225 8:37306948-37306970 TCAGGTCACCTTAAGCTCTCCGG + Intergenic
1041967289 8:63694185-63694207 GAAGGAGACCATGAGCTCTCTGG - Intergenic
1044490728 8:92811180-92811202 GAAGGTCACCATAGGCTCTCTGG - Intergenic
1048277521 8:133078072-133078094 GCACGTCTGCCTGTGCTCTCTGG + Intronic
1051354785 9:16231805-16231827 GGAGGCCACCATGAGCACTCTGG + Intronic
1059784320 9:117564072-117564094 GCAAGTCAGCAGCAGCTCTCAGG - Intergenic
1061668083 9:132172090-132172112 GCCCCTCCCCATGAACTCTCCGG + Intronic
1061844023 9:133376535-133376557 GTACTTCTCCATGGGCTCTCCGG - Exonic
1198393629 X:136201532-136201554 CCACGTCCCCATGAGATCTCAGG - Intronic