ID: 1178417462

View in Genome Browser
Species Human (GRCh38)
Location 21:32415367-32415389
Sequence CTGTGAAGGAGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1696
Summary {0: 1, 1: 2, 2: 13, 3: 161, 4: 1519}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178417462 Original CRISPR CTGTGAAGGAGGAGGGAGGA TGG Intronic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900226173 1:1534562-1534584 CCCTGAGAGAGGAGGGAGGAGGG + Exonic
900227707 1:1540663-1540685 CGGGGAGGGAGGGGGGAGGAGGG - Intergenic
900384036 1:2401271-2401293 GGAGGAAGGAGGAGGGAGGAGGG - Intronic
900391611 1:2436276-2436298 GAGGAAAGGAGGAGGGAGGAAGG - Intronic
900391693 1:2436510-2436532 GAGGAAAGGAGGAGGGAGGAAGG - Intronic
900393871 1:2445170-2445192 CTGGAAAGGATGAGGGAGGCAGG + Intronic
900422803 1:2562919-2562941 GTGGGAAGGTGGAGGGGGGAGGG - Intronic
900572123 1:3363799-3363821 AGGAGAAGGAGGAGGAAGGAAGG + Intronic
900614736 1:3560461-3560483 GGGTGAGGAAGGAGGGAGGAAGG - Intronic
900760114 1:4464626-4464648 CTGTGAAGGTGAGGTGAGGAGGG + Intergenic
900779946 1:4611572-4611594 CCCTAAAGGAGGAGGGAAGATGG + Intergenic
900869536 1:5292236-5292258 CTGTGCAGTAGTAGGGAGCAAGG + Intergenic
900900005 1:5509809-5509831 CCTGGATGGAGGAGGGAGGAGGG + Intergenic
900971873 1:5996343-5996365 GTGTGCAGGAAGAGGGAGGCTGG - Intronic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901332369 1:8420774-8420796 CTGTGAAGGCGGAGGAGTGATGG + Intronic
901447905 1:9319397-9319419 GGAGGAAGGAGGAGGGAGGAGGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901689284 1:10962056-10962078 GTGAGGAGGAGGAGGAAGGAAGG - Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
901787567 1:11634853-11634875 CCCTCCAGGAGGAGGGAGGAGGG + Intergenic
901813179 1:11779142-11779164 CTGTGAAGGCCAAGGGTGGAAGG - Intronic
901865711 1:12105370-12105392 CTGTGAAGGATGAGGGAACGAGG - Intronic
902072572 1:13753101-13753123 CTGTGACGTAGGAGGGAAGAGGG - Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902605221 1:17565371-17565393 ATGTTAAGCAGGAGGGAGAAGGG - Intronic
902661462 1:17906918-17906940 CTGTGGAGGAGGAGGGAGCTGGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902923653 1:19681859-19681881 CTCTGGGGGAGGTGGGAGGAGGG - Intergenic
902990561 1:20184778-20184800 CTAAGAGGGAGGAGGGAGGGAGG + Intergenic
903178863 1:21595500-21595522 CTGAGAAGGCCTAGGGAGGAGGG - Intergenic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
904001206 1:27339813-27339835 CTGCTAAGGAGGTGAGAGGAGGG + Intergenic
904016883 1:27428528-27428550 AGGTGGAGGGGGAGGGAGGAGGG + Intronic
904087179 1:27917083-27917105 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
904319909 1:29689905-29689927 CTGTCAAGGGGGAGGGAGATGGG - Intergenic
904333708 1:29784029-29784051 TGGTGAGGGAGGAGGGAGGATGG - Intergenic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
904357510 1:29950189-29950211 TTGTGAAGGAGAAAGAAGGAAGG - Intergenic
904456524 1:30651457-30651479 CGGGTAAGGAGGAGGTAGGAGGG - Intergenic
904456541 1:30651505-30651527 CGGGTAAGGAGGAGGTAGGAGGG - Intergenic
904456567 1:30651591-30651613 CGGGTAAGGAGGAGGTAGGAGGG - Intergenic
904456624 1:30651763-30651785 CAGGTAAGGAGGAGGTAGGAGGG - Intergenic
904886659 1:33743358-33743380 TTGTGATGGAGGAGGGAAGCTGG + Exonic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905178932 1:36155227-36155249 CTGGGAAGGTGGATGGATGATGG - Intronic
905241125 1:36582247-36582269 CTGTGCAGGGGGACGCAGGATGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905811562 1:40917030-40917052 CTGGGCAGGAGGGTGGAGGATGG + Intergenic
906128225 1:43440644-43440666 CTGGGAAGCAGGAGGGAGTGTGG - Intronic
906215615 1:44036522-44036544 CTAGGAAGGAGGATGGATGAGGG - Intergenic
906591012 1:47023999-47024021 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
906653726 1:47533191-47533213 CAGGGGAGGAGGCGGGAGGAAGG - Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
907325351 1:53634549-53634571 ATGTGAGGGTGGAGCGAGGAGGG + Intronic
907525050 1:55049243-55049265 CTGTGAGGCAGGAGGGAGTGTGG + Intronic
907629527 1:56066362-56066384 TTTTGAAGCAGGATGGAGGATGG + Intergenic
907718002 1:56945721-56945743 CTGTGAAGGTGTAGCCAGGAAGG + Intronic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908016686 1:59846582-59846604 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
908108629 1:60873021-60873043 CTGTGAAGGAGAGGGGTTGAAGG - Intronic
908437523 1:64121195-64121217 CAGGGGAGGAGGAGGGAGGGAGG - Intronic
908877237 1:68691462-68691484 CTGCCATGGACGAGGGAGGATGG + Intergenic
909010079 1:70324320-70324342 CTGGGTAGGAGGAGGGAGAGTGG + Intronic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
909431058 1:75588252-75588274 GAGGGAAGGAGGGGGGAGGAAGG + Intronic
910240319 1:85079517-85079539 TTGAGAAGTTGGAGGGAGGATGG + Intronic
910245598 1:85135079-85135101 GTGTGATGGAGGGGAGAGGAAGG - Intergenic
910410385 1:86937251-86937273 CTGGAAGGAAGGAGGGAGGAAGG - Intronic
910425378 1:87115619-87115641 CTGAGCAGGAGGAGGGAGACAGG - Intronic
910521296 1:88124844-88124866 GAGTGAAGGAAGAGGAAGGAAGG + Intergenic
910552174 1:88487789-88487811 CAATGAAGAAGGAGGGAGGAAGG + Intergenic
910758228 1:90712703-90712725 GAATGAAGGAGGAGGCAGGAAGG - Intronic
911113104 1:94212899-94212921 CTGTGAAGGAGGAGTAAAGTTGG - Intronic
911127680 1:94355638-94355660 CTCTCAATGAGGAGGGGGGAAGG - Intergenic
911330302 1:96518981-96519003 CTGTCAAGGAGAAGAGAAGAAGG + Intergenic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
912380651 1:109246443-109246465 CTGGGAAGGAGGGGTGGGGAGGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912503469 1:110137888-110137910 CTCAAAAGGAGGAGGCAGGAGGG + Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913128505 1:115815648-115815670 CTGTGAAGGACAAGGGAGGGAGG + Intergenic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
914900431 1:151708621-151708643 CTGTGCAGGGGCAGGGAAGAGGG + Intronic
915035320 1:152918759-152918781 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915329837 1:155103999-155104021 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
915509106 1:156376874-156376896 CTCTGAAGTATGAGGGATGAAGG + Intronic
915584434 1:156836611-156836633 CCATGAAAGAGGAGGGAGGAGGG - Intronic
915630576 1:157151181-157151203 CTGGGAAGGAAGAGTAAGGAAGG + Intergenic
915643371 1:157247624-157247646 CATTCAAGGAGGAGGGAGAAGGG - Intergenic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916015047 1:160742324-160742346 CTTTGAAGGTGGAGGGAGCTGGG - Intronic
916075360 1:161197362-161197384 TAGAGAGGGAGGAGGGAGGAGGG + Intronic
916942879 1:169694700-169694722 CTGTGAAGGAGAAGTGGGGCAGG - Intronic
917313594 1:173702595-173702617 AGGAGAAGGAGGAAGGAGGAAGG + Intergenic
917337101 1:173936064-173936086 CTGTGAAGTAGGCAGGAGCAGGG - Exonic
918248555 1:182681722-182681744 CTGAGCTGGAGGCGGGAGGAGGG + Intronic
918421916 1:184372937-184372959 ATGGGAAGGAGGAGGTAGCAAGG + Intergenic
918484998 1:185019346-185019368 CTGTGAAGGCACAGGGAGTAAGG - Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918674208 1:187261552-187261574 CCTTGAATGAGGAAGGAGGATGG + Intergenic
918918201 1:190671588-190671610 CTGGGAAAGAGGAGGCAGGGTGG + Intergenic
919345313 1:196368771-196368793 ATGTGAAGGAGGAAGTAGTAGGG - Intronic
919417529 1:197330158-197330180 ATGTAAAGGAGGAGGGAGAGGGG - Intronic
919434828 1:197544961-197544983 AGGAGAAGGAGGAAGGAGGAAGG + Intronic
919608061 1:199710639-199710661 CAGTGAGGGAGGAGGATGGAGGG + Intergenic
919664184 1:200276364-200276386 ATGTGTGGGAGGAGAGAGGATGG - Intergenic
919750770 1:201036690-201036712 CTGTAACGGAGGAGAGAGGGCGG + Intergenic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920034625 1:203057959-203057981 TTGAGAAGGAGGAGGGTGGGCGG + Intronic
920092428 1:203464131-203464153 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920400490 1:205673164-205673186 CTGGGAAGGACTAGGGAAGAGGG - Intronic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
921155948 1:212438955-212438977 CTGAGAAGGTGGAGGGTGGGTGG - Intronic
921338432 1:214110905-214110927 TAATGAAGGAGGGGGGAGGATGG - Intergenic
921363101 1:214348406-214348428 CAGTGAAGGAGGAGTGAGTAGGG + Intergenic
921490786 1:215773238-215773260 CTGACAAGGAGAAGGGAAGATGG - Intronic
921676615 1:217983168-217983190 TGTTGAGGGAGGAGGGAGGAGGG + Intergenic
921801164 1:219404069-219404091 CAGAGAAGGAGGAGAGAGGGAGG + Intergenic
921957612 1:221000477-221000499 AGGGGAAGGAAGAGGGAGGAAGG - Intergenic
922001869 1:221487063-221487085 CTGAGAGGGAGTAAGGAGGAAGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922447416 1:225709135-225709157 CTGTGAAGTAGGAGGTAGGGGGG + Intergenic
922604241 1:226879354-226879376 CTCTGAGTGAAGAGGGAGGAGGG + Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922716717 1:227879479-227879501 GTGACAAGGAGGAGGGAAGAAGG + Intergenic
922722595 1:227906379-227906401 TGGAGTAGGAGGAGGGAGGAGGG - Intergenic
923018055 1:230142153-230142175 CTGTGGAGGTGGGGGGAGGGTGG + Intronic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923099496 1:230801060-230801082 TTGGGAAGGAGGAGGCAGGGTGG + Intronic
923263651 1:232291488-232291510 CTGAGAAGGAAGATGGAAGAAGG + Intergenic
923491423 1:234487489-234487511 CAGCGAGGGAGAAGGGAGGATGG - Intergenic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
923854210 1:237828530-237828552 GTGGGAAGGAGGAGGGGGAAGGG + Intronic
923989770 1:239423452-239423474 CTATGGAGGAGGATGGAGGCGGG + Intronic
924058352 1:240145357-240145379 CGGAGATGGAGGAGGGAGGATGG - Intronic
924189490 1:241535270-241535292 ATGGAAAGGAGGAGGTAGGAAGG - Intronic
924290484 1:242531219-242531241 CACTGAATCAGGAGGGAGGAGGG - Intergenic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
924608667 1:245556292-245556314 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924608678 1:245556338-245556360 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924864867 1:247967878-247967900 CGAGGAAGGAGGAGGAAGGAAGG - Intronic
1062954959 10:1534020-1534042 CTTTGATGGGGGAGGGAGGGAGG + Intronic
1062989942 10:1805976-1805998 GTGTGACGAAGGAGGGATGAAGG - Intergenic
1063185489 10:3646891-3646913 CCATGCAGGAGGAAGGAGGAAGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063377459 10:5562512-5562534 CTCTGAGGGAGGAGGAGGGAGGG - Intergenic
1063467636 10:6257760-6257782 TTGTGAAGGAGTAGGGAAGCTGG + Intergenic
1063571180 10:7215754-7215776 CAGGGAAGGAGGAGGGAAGCAGG - Intronic
1063598443 10:7458650-7458672 CAGTGAAGGAGTGGGAAGGAAGG - Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1064453506 10:15465443-15465465 CTGGGAAGAAGCAGGGAGGCAGG - Intergenic
1065324979 10:24542860-24542882 CTGAGAGGGAGAACGGAGGAGGG - Intronic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066228829 10:33411987-33412009 CTGTGAGGGTGAAGGCAGGAAGG + Intergenic
1066260478 10:33724955-33724977 TTCTGAGGCAGGAGGGAGGAGGG - Intergenic
1066397588 10:35041256-35041278 AGGTGAAGGAGGATGGAAGAAGG + Intronic
1067053466 10:43038327-43038349 CTGGGAGGGTGGAGGGAGGCGGG + Intergenic
1067083822 10:43227917-43227939 CAGAGAAGGAGGAGGAGGGAAGG - Intronic
1067250854 10:44586315-44586337 CTCTGCAGGTGAAGGGAGGATGG + Intergenic
1067438122 10:46292972-46292994 CTGAGATGAAGGAGGGATGACGG + Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067461960 10:46464955-46464977 CAGAGAAGGAGCAGGGAGCAGGG + Intronic
1067567249 10:47348381-47348403 CTGAGAAGGACAAGGGCGGAAGG + Exonic
1067580111 10:47439421-47439443 CTGTGTAGGATGAGGGAGTTAGG + Intergenic
1067582149 10:47452644-47452666 CTGGGAAGCTGGAGGGAGGCAGG - Intergenic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067625235 10:47919643-47919665 CAGAGAAGGAGCAGGGAGCAGGG - Intergenic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067833527 10:49623861-49623883 CAGGGAAGGAGGAGGGAGCTTGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068116897 10:52745980-52746002 CTGTCAAGGGGGTGGGAAGAGGG - Intergenic
1068189316 10:53629669-53629691 CAGAGAAGGAGGTGTGAGGAGGG + Intergenic
1068255186 10:54500291-54500313 ACTTGAAGGGGGAGGGAGGAGGG + Intronic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068905331 10:62315785-62315807 CAGCGATAGAGGAGGGAGGAGGG + Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1070144172 10:73761680-73761702 CACTGAAGGAGGGGGAAGGAAGG - Intronic
1070314101 10:75294699-75294721 CGGGGAAGGAAGAGAGAGGAGGG + Intergenic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070737874 10:78876883-78876905 ATGGGAATGAGGAGGAAGGAAGG - Intergenic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1070763858 10:79045148-79045170 AGCTGAAGGAGGAGGGATGAGGG + Intergenic
1070979064 10:80630022-80630044 CTGTGAAGGACAAAGGGGGAGGG + Intronic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071256820 10:83878774-83878796 CTGTGAAGGAGGTGGGAGAGGGG - Intergenic
1071531228 10:86391615-86391637 CTGAGGAGGAGGAGTGAGCAAGG + Intergenic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1072323428 10:94273049-94273071 CTGTCAAGGAGGTGGGTGGAGGG - Intronic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1073063420 10:100745317-100745339 CGGCGAAGGAAGAGGGAGGGAGG - Intronic
1073073593 10:100809756-100809778 CTGGGAAGCAGGAGGAAGGCTGG - Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073911221 10:108347054-108347076 GAGGGAAAGAGGAGGGAGGAAGG + Intergenic
1073988855 10:109240691-109240713 GAGGGAAGGAGGAGGGGGGATGG + Intergenic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074276099 10:112004214-112004236 CTGACAAGGAGAAGGAAGGAAGG - Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074781282 10:116804134-116804156 TTTGGAGGGAGGAGGGAGGAAGG - Intergenic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1075066521 10:119292343-119292365 TTGTGAAGGAAGAGGAAGAAAGG - Intronic
1075188598 10:120285715-120285737 CTTTGAAGCAGGAAGGAGGTAGG - Intergenic
1075316138 10:121455160-121455182 CCAGGAAGGAGAAGGGAGGATGG - Intergenic
1075452516 10:122561826-122561848 CAGAGAAGGAGGAGGAGGGAGGG - Intronic
1075558092 10:123447733-123447755 CCAACAAGGAGGAGGGAGGAGGG + Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076725331 10:132410451-132410473 CTGTGCGGGAGCAGGAAGGAGGG + Intronic
1076741547 10:132488211-132488233 CTTGGATGGAGGATGGAGGATGG + Intergenic
1076897219 10:133318617-133318639 CTGTGAAGGAGGACGGAGACCGG - Intronic
1076908423 10:133374921-133374943 AGGTGAAGGAGAAGGAAGGAAGG - Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077072798 11:684726-684748 CTGTGACGTATCAGGGAGGAGGG + Intronic
1077268567 11:1664602-1664624 AAGGGAAGGGGGAGGGAGGAGGG + Intergenic
1077307179 11:1873636-1873658 AATGGAAGGAGGAGGGAGGAGGG + Intronic
1077391844 11:2303933-2303955 GAGGGAAGGAGGAGGGAGGTGGG - Intronic
1077412172 11:2408700-2408722 CGGGGCAGGAGGAGGGAGGAGGG + Intronic
1077483867 11:2830039-2830061 GGAGGAAGGAGGAGGGAGGAGGG + Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077491715 11:2863864-2863886 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077555566 11:3224440-3224462 CTGGGAGGAAGGAGGGAGGGAGG - Intergenic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078127312 11:8580467-8580489 CTGGGAAGGAGAATGGAGGGAGG + Intronic
1078361984 11:10676195-10676217 AAGTGATGGAGGAGTGAGGAGGG + Intronic
1078519572 11:12052360-12052382 CAGAGAAGGAGGTGCGAGGATGG + Intergenic
1078840566 11:15073111-15073133 CAGGGAAGGAGGGGGGGGGAGGG - Intronic
1078859228 11:15231991-15232013 CTGTGAGGTAGGAAGGAGGTTGG - Intronic
1079035361 11:17015070-17015092 ATGTGAAACAGGAGGGAGCAGGG + Intergenic
1079309237 11:19349795-19349817 CAGGGAGGGAGGAGAGAGGAAGG - Intergenic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079376421 11:19896058-19896080 CGGTGAAGGAGCAGGGGTGATGG - Intronic
1079826412 11:25200994-25201016 GAATGAAGGAGGAGGGAGGGAGG + Intergenic
1080447846 11:32353632-32353654 CTGTGTAGGAGGCTGGAGAATGG - Intergenic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1081113696 11:39171046-39171068 CTGAGAAGGAGAATGGAGGGAGG + Intergenic
1081244309 11:40746061-40746083 CAATGAAGGAGGAGGAAGCAAGG + Intronic
1081447651 11:43145977-43145999 CTGAGAAGGGGCAGAGAGGAGGG + Intergenic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081930554 11:46867978-46868000 CTCTGGAGGAGGTGGAAGGAAGG - Exonic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1083253050 11:61480950-61480972 CTGTGGAGGAGGCCGGAGGTTGG + Intronic
1083292063 11:61695954-61695976 CGGGGAAGGAGGTGGGAGAACGG - Intronic
1083330825 11:61897648-61897670 TTATGAAGGGGGAGGGAGGAAGG + Exonic
1083826398 11:65206437-65206459 GTGGGAGGGAGGAGGGAGCAGGG - Intronic
1084104874 11:66974976-66974998 AGGAGAAGGAGGAGGGGGGAGGG + Intergenic
1084104899 11:66975029-66975051 GGGAGAAGGAGGGGGGAGGATGG + Intergenic
1084181056 11:67446218-67446240 CTATGAAGGAGAGGGAAGGAAGG + Intergenic
1084185109 11:67467413-67467435 ATGTGAAGGAGGTGGAGGGAGGG + Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084462381 11:69303080-69303102 CTGTGGAGCAGTAGGGAGGCTGG + Intronic
1084565871 11:69928447-69928469 GTGGGAAGGAGGGGGAAGGAGGG + Intergenic
1084724767 11:70934366-70934388 CTGAGAAGCAGGAGGGAGGCCGG - Intronic
1084951389 11:72667924-72667946 CTGAGAAGAAGCATGGAGGAGGG + Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085084163 11:73655761-73655783 CCAAGAAGGAGGAGGGAGGGAGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085310039 11:75510752-75510774 CGGAGGAGGAGGAGGGGGGAGGG - Intronic
1085516247 11:77113433-77113455 CCAGGAGGGAGGAGGGAGGAGGG + Intronic
1085665633 11:78413575-78413597 CTGAGAAGAAGGTGGGAGAAAGG + Intronic
1086571640 11:88291527-88291549 GAGGGAAGGAGGAAGGAGGAAGG + Intergenic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087125568 11:94622565-94622587 TTGTGAAGCATGAGGGTGGAGGG + Intergenic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087796335 11:102458247-102458269 CTGTAAAGGAGGAGACAAGAAGG - Intronic
1088319002 11:108535546-108535568 TTTGGAAGGAGGAGGGAGGCAGG + Intronic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088799843 11:113295676-113295698 CTGTTAAAGAGAAGGGAAGATGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089316905 11:117598145-117598167 CAGTGGAGGAGAAGGGAGGGAGG - Intronic
1089335562 11:117720574-117720596 GTGAGAAGGAGGAGGAAGCATGG - Intronic
1089336212 11:117725664-117725686 GTCTGCAGGAGGAGGGAGGCCGG + Intronic
1089341554 11:117761373-117761395 CTCTGTAGGAGGAGGAAGGGAGG - Intronic
1089733726 11:120535364-120535386 GTGTGAAGGGGGAGGTAAGAGGG + Intronic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090623552 11:128584856-128584878 AAGGGAAGGAGGAGGGAAGAGGG + Intronic
1090653475 11:128825427-128825449 CTGAGAAGGAGGGAGCAGGAAGG + Intergenic
1090654422 11:128832121-128832143 CAAGGAAGGAGGAGGGATGAAGG - Intergenic
1090674025 11:128972528-128972550 CTGGGAAGGCGGAGGGGGAAGGG + Exonic
1091004399 11:131939547-131939569 CTGTGCAGATGGAGGGAGTATGG + Intronic
1091012318 11:132014039-132014061 CTGTGAAGGGGTGGAGAGGAAGG - Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1091207578 11:133832306-133832328 CTTTTAAGGAGGAGGCGGGAAGG - Intergenic
1091278484 11:134368623-134368645 CTCTGCCGGAGGAGGGAGAAAGG - Exonic
1091290031 11:134434330-134434352 CTCTGCAGGAGGAGGGAAGTAGG - Intergenic
1091600055 12:1912568-1912590 ATGAGAAGGAGGAGAGGGGAGGG + Intronic
1091660068 12:2376817-2376839 CTGTGAAGCAGGGAGGAGGTGGG - Intronic
1091671701 12:2456746-2456768 CTGAGGAGGAGGAGCGGGGAGGG - Intronic
1091691817 12:2602243-2602265 CCGTGGTGGAGGAGGCAGGAAGG - Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1091776257 12:3186828-3186850 CTGGGGAGGAGGGGGCAGGATGG + Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092239874 12:6829836-6829858 CTGAGGAGGCGAAGGGAGGAGGG - Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092751089 12:11719816-11719838 GTGTGAGGGAAGAGGAAGGAAGG - Intronic
1092872067 12:12814065-12814087 CAGTTAAGTAGGAGGGAGGTAGG + Intronic
1092926294 12:13275483-13275505 CGGAGAAGGAGGAGAGGGGATGG - Intergenic
1093000841 12:13993941-13993963 GGGGGAAGGGGGAGGGAGGAAGG + Intergenic
1093111791 12:15161467-15161489 ATGGGAAGAAGGAGGAAGGAAGG - Intronic
1093625945 12:21348367-21348389 CTGTGAGGGAGAGGTGAGGATGG - Intronic
1093850712 12:24034346-24034368 CTGAGAGGCAGGAGAGAGGAGGG - Intergenic
1094079702 12:26520001-26520023 CTGGGAGGTAGGTGGGAGGATGG + Intronic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1094189556 12:27683578-27683600 GGTTAAAGGAGGAGGGAGGAAGG + Intronic
1094524848 12:31224834-31224856 GTCTGAAGGAGGAGGGGGCAAGG - Intergenic
1095745164 12:45650054-45650076 GTGTGAAGGAGGAGTCCGGAGGG - Intergenic
1095802597 12:46283908-46283930 CTGTGAAGCAGCAGGCTGGAGGG + Intergenic
1095921092 12:47532317-47532339 CTGTGAACCAGGTGGGTGGATGG + Intergenic
1095957403 12:47814446-47814468 AAGGGAAGGAGGTGGGAGGAAGG + Intronic
1096016477 12:48280740-48280762 CAGAGAAGGAGGAAGGACGAGGG - Intergenic
1096087198 12:48873686-48873708 CTAAGAATGAGGAGGGAGGCTGG + Intergenic
1096154329 12:49333338-49333360 CTGGGGAGGACCAGGGAGGAGGG + Intronic
1096199075 12:49668439-49668461 TTGGGAAAGAGGAGGGAGGTAGG - Intronic
1096221100 12:49828475-49828497 CTGCTAGGGAGGAGGGAGGCGGG - Intronic
1096335989 12:50756997-50757019 CAGTCAAGAAGGAGGGAGGGAGG - Intergenic
1096575982 12:52553097-52553119 CTCAGATGCAGGAGGGAGGAAGG + Exonic
1096667123 12:53173316-53173338 ATGGGAAGGAGGAGGAAGAAAGG + Intronic
1097173244 12:57128851-57128873 CAGAGAAGGAGGAGGGGGAAAGG + Exonic
1097192943 12:57228505-57228527 CTGGGAAGGTTGAGGCAGGAGGG - Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097285201 12:57871930-57871952 ATATGAAGGAGGAGGTAGGTGGG - Intergenic
1097616643 12:61891689-61891711 AGGAGAAGGAGGAGGGAGGTTGG + Intronic
1097620955 12:61938900-61938922 CTCAGAAGGAGGAGGGTGGGAGG + Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098116548 12:67184740-67184762 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098384956 12:69908910-69908932 TTTTGAAGGTGGAGGGTGGAGGG - Intronic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1098542374 12:71671041-71671063 CTGAGGAGGAGGAGGAAGAAGGG + Intronic
1099271741 12:80519532-80519554 CTTTGAAGGAGGAGGGATCGGGG + Intronic
1099355122 12:81624819-81624841 CTCAGAAGGGGGAGGGTGGAGGG + Intronic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100386520 12:94109215-94109237 GCGTGGAGGAGGAGGGAGAAGGG + Intergenic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1100861121 12:98808490-98808512 GAGTGAAGGAGGTGGCAGGAAGG + Intronic
1101058952 12:100950747-100950769 CTGTGAAGGTGGTGAGAGGTAGG + Intronic
1101876172 12:108598118-108598140 CGGGGAGGGAGGAAGGAGGAGGG - Exonic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102078384 12:110078203-110078225 ATGCGAAGCAGGTGGGAGGAGGG + Intergenic
1102139887 12:110605882-110605904 CGGTGGAGGAGGAGAGAGCAGGG + Intergenic
1102194721 12:111016889-111016911 GAGAGAGGGAGGAGGGAGGAAGG - Intergenic
1102225624 12:111226247-111226269 TTATCAAAGAGGAGGGAGGATGG - Intronic
1102258325 12:111428828-111428850 CTGTAAAGGAGGTGTGAGGGCGG - Intronic
1102394359 12:112574544-112574566 GGGTGATGGAGGAGGGAGGGGGG + Intronic
1102598781 12:114013012-114013034 GGGAGAGGGAGGAGGGAGGAGGG + Intergenic
1102650914 12:114441836-114441858 CAATGAAGGAGGCAGGAGGAGGG - Intergenic
1102805534 12:115776639-115776661 AGGATAAGGAGGAGGGAGGAAGG - Intergenic
1102835402 12:116053620-116053642 CTTTGAAGCAGAAGGGAGGAAGG + Intronic
1102998145 12:117365161-117365183 CTGGGCAGGAGGAGGAAGGGAGG + Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103320684 12:120091158-120091180 CTGTGATGGAGGAGGGAGCTGGG - Intronic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104647403 12:130506977-130506999 CTGTGGTGGAGGTGGGAGGGAGG - Intronic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104848720 12:131860794-131860816 ATGTGAGGGAAGAGGGAGGGAGG + Intergenic
1104894755 12:132158711-132158733 CTGTGAAGGCTGCGGGATGAGGG - Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1105775203 13:23653443-23653465 CTGTGAAGGAAGAGAAAGCAGGG + Intronic
1105812701 13:24008881-24008903 CAGCCAAGGAGGAGGGAAGAGGG + Intronic
1106318162 13:28613568-28613590 TTGTGAAGTATGGGGGAGGAAGG - Intergenic
1106389964 13:29325511-29325533 AGGAGGAGGAGGAGGGAGGAAGG + Intronic
1106570275 13:30920875-30920897 TTGTGAGGGAGCAGAGAGGAAGG + Intronic
1106682088 13:32018412-32018434 CTGAGAACGAGATGGGAGGAGGG + Intergenic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1107890062 13:44906261-44906283 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1108008027 13:45972436-45972458 CTCAGAAGGGGGAGGGTGGAAGG + Intronic
1108028089 13:46199687-46199709 ATATGAAGGAGAAGGGAGGGTGG + Intronic
1108166398 13:47697780-47697802 AAGTGAAGGAAGAGGAAGGAAGG - Intergenic
1108577609 13:51803431-51803453 CTGTGACGGAGGAGAGATGGAGG - Intronic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1109215751 13:59587894-59587916 CTTTGAAGCAGGAGGTAGGATGG - Intergenic
1109493932 13:63143161-63143183 GTGGGAGGGAGGAGGGAGGAAGG + Intergenic
1110758288 13:79201600-79201622 ATAAGAAGGAGCAGGGAGGAGGG - Intergenic
1111048512 13:82847072-82847094 AAGGGAGGGAGGAGGGAGGAAGG + Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111449704 13:88398760-88398782 GTGGGAAGGAGGAGGAAGAAAGG + Intergenic
1111622848 13:90746712-90746734 AGGAGAAGGAGGAGGGAGGAGGG - Intergenic
1111721429 13:91950343-91950365 CTGGGAGGGAGGAGGAGGGAGGG - Intronic
1112260674 13:97875261-97875283 CTTTGAAGGGTGAGGGAGAATGG + Intergenic
1112328863 13:98462062-98462084 CTGTGAGGGAGGAGGCGGGGGGG - Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1112489371 13:99848168-99848190 CTGAGAAGGGGGTTGGAGGAGGG - Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112855020 13:103757888-103757910 AGGTGGAGGAGGAGGCAGGAGGG - Intergenic
1113007814 13:105727209-105727231 CCTTGATGGAGGAGGGTGGAGGG - Intergenic
1113100009 13:106707080-106707102 GTGGGAAGGAGTAGGGAGGTTGG + Intergenic
1113150476 13:107257769-107257791 CTGTGATGGTGGTGGGAGGTAGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113222776 13:108124244-108124266 CTGACAAAGAGGAGGGAAGATGG - Intergenic
1113375196 13:109758943-109758965 AAGGGAAGGAGAAGGGAGGAAGG + Intronic
1113467829 13:110524643-110524665 GTGTAAAGGAGGAGGGTGAAGGG - Intronic
1113618465 13:111697239-111697261 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113623994 13:111782500-111782522 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114664967 14:24372354-24372376 CTGTGAGGGAGGAGGGGGTATGG - Intronic
1115292490 14:31788268-31788290 CTCTGAAAGAGGAGGCAGAATGG + Intronic
1115641238 14:35336920-35336942 CTGTGAGGAAGGGTGGAGGAGGG + Intergenic
1115850937 14:37589470-37589492 CTCTGGAGGAGGTGGGAGGAGGG - Intergenic
1116116463 14:40658018-40658040 CTGGGAAGGATGCTGGAGGAAGG - Intergenic
1116663796 14:47748718-47748740 CTGAGATGGAGGAGGAAGAAGGG - Intergenic
1116946216 14:50837575-50837597 GTGGGATGGAGGATGGAGGACGG - Intergenic
1117181104 14:53192591-53192613 CTGTCAGGGAGGAAGGAAGAAGG + Intergenic
1117803515 14:59467485-59467507 CTGAGAAAGATGAGGAAGGAAGG - Intronic
1117957060 14:61130969-61130991 TCCTGGAGGAGGAGGGAGGAGGG - Intergenic
1118107680 14:62678690-62678712 ATATGGAGGTGGAGGGAGGAAGG + Intergenic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118758526 14:68863326-68863348 CTGGGAAGAAGCAGGGGGGAAGG + Intergenic
1118982231 14:70726193-70726215 AAGGGAAGGAGGAGGGAGGGAGG + Intronic
1119080579 14:71689837-71689859 CTGTAAGGAAGGAGGGAGGGAGG - Intronic
1119569946 14:75661313-75661335 TGGGGAAGGAGGAGGGAGGTAGG + Exonic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119705946 14:76782608-76782630 CTCTGAAGGAGTGGGGAGGTGGG + Exonic
1119739960 14:77007928-77007950 CTGGGAAGGAGAGGGTAGGAGGG - Intergenic
1120143589 14:80955514-80955536 CTGTGGAGGAGGCTGGAGAAGGG - Exonic
1120415351 14:84212665-84212687 ACTTGAAGGTGGAGGGAGGATGG - Intergenic
1120881370 14:89417258-89417280 CGGGGAGGGAGGAGGGCGGAGGG + Intronic
1121031333 14:90661051-90661073 CTGTGAAGGGGCAGGGCTGAGGG - Intronic
1121117561 14:91354388-91354410 CTGTGAGGGAGGATGCTGGATGG - Intronic
1121120506 14:91372978-91373000 TGTTGAAGCAGGAGGGAGGATGG - Intronic
1121148537 14:91607853-91607875 CTCTAAAGGTGGAGGGAGGGAGG - Intronic
1121241135 14:92430808-92430830 ATCTGAAGGTGGAGGGAGGAGGG - Intronic
1121298197 14:92847326-92847348 CTTTGAAGGTGGAGGAAGGAAGG + Intergenic
1121358210 14:93232350-93232372 CTGCCTGGGAGGAGGGAGGAAGG - Intergenic
1121567754 14:94923501-94923523 CAGTGAAGGTGGAGGGGGGGAGG - Intergenic
1122200989 14:100122533-100122555 CTATGAAGTAGGAGGGAACAGGG + Intronic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122549051 14:102540092-102540114 CTCTGGAGGAGGAGGCCGGATGG - Intergenic
1122926363 14:104904709-104904731 CTTCAAAGGAGGAGGGAGGAGGG - Intergenic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123214305 14:106792248-106792270 CTGTGAGGCATGCGGGAGGAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123679915 15:22755463-22755485 GAGTCAAGGAGGAAGGAGGAGGG - Intergenic
1124332129 15:28829911-28829933 GAGTCAAGGAGGAAGGAGGAGGG - Intergenic
1124833054 15:33167927-33167949 AAGTGAAGGAGAAGGGAGGGAGG + Intronic
1125172284 15:36779257-36779279 CTGTGAAGGAGGAGTAAGGCTGG - Intronic
1125685088 15:41559203-41559225 CCGCGAGCGAGGAGGGAGGAGGG - Exonic
1125759173 15:42085270-42085292 CTTTGCAGGAGGAGAGGGGAGGG + Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1127772720 15:62244043-62244065 CTGGGAGGGAGGAGAGAGGGAGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1127976530 15:64001378-64001400 CGGGGTAGGAGGAGGAAGGAAGG - Intronic
1128347830 15:66865785-66865807 AGGTGAAGGAGGAGAGAGGAAGG - Intergenic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128647495 15:69388128-69388150 CAGGGAGGGAGGAGGGAGGCAGG - Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1128898451 15:71397227-71397249 ATGTGAAGGGGAGGGGAGGAAGG - Intronic
1128899036 15:71402490-71402512 CTGTGATGGATGTGGGAGGCAGG + Intronic
1128992890 15:72275180-72275202 CTGTGAAGCAGAATGGGGGATGG - Intronic
1129291871 15:74574505-74574527 AGGTAAAGGAGTAGGGAGGAAGG - Intronic
1129426458 15:75467040-75467062 CTGGGAGGGATGAGGGAGGCAGG - Exonic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1129451503 15:75653627-75653649 AGGCGAAAGAGGAGGGAGGAAGG + Intronic
1129477871 15:75798453-75798475 CTGTGAAGAAGGTGAAAGGAAGG + Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129524039 15:76202943-76202965 CTTTGAGGGAGGAGAGAAGAGGG - Intronic
1129878578 15:78992836-78992858 CTGTGGAGGAAATGGGAGGAAGG - Intronic
1129892869 15:79083168-79083190 CAGTGAAGGAGGCTGGAGGCTGG + Intronic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1130054614 15:80511781-80511803 CTGAGAAGGAGCAGAGAGGCAGG + Intronic
1130541187 15:84821853-84821875 TTGAGCAGTAGGAGGGAGGAAGG + Intronic
1130561973 15:84965879-84965901 CTGTTAAGCTGGAGGGAGGCGGG + Intergenic
1130721100 15:86386257-86386279 AGGAGGAGGAGGAGGGAGGAGGG - Intronic
1130937579 15:88483237-88483259 CTGTGAAGGAGGTGGGACAGAGG + Intergenic
1131086371 15:89578926-89578948 CTGTCCAGGAGCAGGGAGAAGGG + Intronic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131139826 15:89968116-89968138 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1131174436 15:90201253-90201275 CCGGGAAGGAGGAAGGGGGAAGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131233077 15:90673627-90673649 CTCTGAAGAAAGAGGGAGGGAGG - Intergenic
1131273998 15:90965329-90965351 CTGGGAAGGAGGAGTGAGAAAGG + Intergenic
1131649870 15:94387122-94387144 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
1131764792 15:95663844-95663866 ATGTGTTGGAGGAGGGGGGAGGG + Intergenic
1131846584 15:96495352-96495374 CAGAGAAGGAGGAGGGTGGAAGG + Intergenic
1132266655 15:100478928-100478950 ATTTGAAGGAGGAGGGTGTATGG + Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132925224 16:2425802-2425824 CTCTGAGGGAGGAGGCAGGGAGG - Intergenic
1132989666 16:2786283-2786305 CTGTGAAGGTGCAGGGGGCAAGG + Intronic
1133091848 16:3410993-3411015 GTGAGAGGGAGGAGGCAGGAGGG - Intronic
1133112101 16:3554185-3554207 CCTTGGAGGAGGAGGGAGAAGGG + Intronic
1133345323 16:5065983-5066005 GTGGGAAGGAGGTGGGAGGAGGG - Exonic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133520249 16:6549432-6549454 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1133582612 16:7160820-7160842 GGAGGAAGGAGGAGGGAGGAGGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133797526 16:9058240-9058262 AAGTGAAGGAGGAGAGAAGATGG + Intergenic
1133953977 16:10423748-10423770 CTGATGAGGAGGAGGAAGGAGGG - Intronic
1133998574 16:10765663-10765685 GTGTGAGGGAGGTGGGAAGATGG - Intronic
1134001629 16:10787437-10787459 CTGGAAAGGAGAAGGGAAGATGG - Intronic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134215132 16:12311428-12311450 CAGGAAAGGAGGACGGAGGAGGG - Intronic
1134229443 16:12417565-12417587 ATGAGAAGGAGGAGGAAAGAGGG - Intronic
1134655826 16:15947948-15947970 GAGGGAAGGAGGAAGGAGGAAGG - Intergenic
1135721580 16:24822554-24822576 CCCTGAGGGAGGAGGGAGGTGGG - Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1136138863 16:28276054-28276076 AAGTGGAGGAGGAGGGAGGCTGG + Intergenic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136485860 16:30571396-30571418 CGGTGAAGGAGGAGGGGGCTCGG + Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136557796 16:31018434-31018456 AGGTGATGAAGGAGGGAGGAGGG + Intergenic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137374415 16:47940536-47940558 CTGGGATGGAGGATGGAGGATGG - Intergenic
1137585183 16:49659999-49660021 GGGTGGAGGAGGAGGAAGGAAGG - Intronic
1137668433 16:50265633-50265655 CTGTGATGGAGGAAGGTGCAGGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137709242 16:50555086-50555108 CTGGGAGGGAGGGGGCAGGATGG + Intronic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138170551 16:54845223-54845245 GTAGCAAGGAGGAGGGAGGATGG + Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138483014 16:57316649-57316671 CTGTGAATGAGTATGGGGGAAGG + Intergenic
1138501668 16:57449087-57449109 AAATGAGGGAGGAGGGAGGAAGG + Intronic
1138984603 16:62313164-62313186 CTATGAACGAGGTGGGAGGAAGG - Intergenic
1139138914 16:64237447-64237469 CTGTGAAGGGCATGGGAGGAAGG + Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139435107 16:66932415-66932437 CTGGGAAGGAGGTGACAGGAGGG - Intronic
1139457334 16:67092057-67092079 CTGTCAAGGGGTAGGGGGGAAGG - Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1139918206 16:70441010-70441032 CTTTTAATGTGGAGGGAGGAGGG - Intergenic
1139946291 16:70644759-70644781 AGGAAAAGGAGGAGGGAGGAGGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140145810 16:72307321-72307343 CTATGAGTCAGGAGGGAGGAAGG + Intergenic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1141177140 16:81728523-81728545 GAGGGAGGGAGGAGGGAGGAAGG - Intergenic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141427140 16:83951880-83951902 GAGAGAAGGAGGAAGGAGGAAGG - Intronic
1141514576 16:84535147-84535169 GGGAGAAGGAGGAGGGAGTAGGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141775759 16:86121749-86121771 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
1141775823 16:86121956-86121978 GGGACAAGGAGGAGGGAGGAAGG - Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1141946043 16:87310786-87310808 GTGGGAAGGAGGAGGCAGGGAGG + Intronic
1142008200 16:87700451-87700473 CAGATAAGGCGGAGGGAGGAGGG + Intronic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142269034 16:89079577-89079599 CTCTGCAGGAGGGCGGAGGAGGG - Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142289715 16:89187988-89188010 CTGGGAGGCAGGAGGGAGGGTGG + Intronic
1142290962 16:89193387-89193409 CTGCGAAGGAGGTGGGAGGAGGG - Intronic
1142419714 16:89962897-89962919 CGGTGAGGGAGGAGGTAGGGCGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142676188 17:1514841-1514863 CTGCTAGGGAGGAGAGAGGAAGG - Intronic
1142836867 17:2593884-2593906 GAGGGAAGGAGGGGGGAGGATGG - Exonic
1142889256 17:2932361-2932383 CAGTGGAGGAGGAGGGAGACTGG + Intronic
1142958220 17:3535376-3535398 GGGAGAGGGAGGAGGGAGGAAGG - Intronic
1142978106 17:3657072-3657094 CTGCCAGGGAGGAGGGAGGAGGG + Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143355687 17:6326307-6326329 CTGGGAAGGGGGAGAGACGAGGG + Intergenic
1144145053 17:12389294-12389316 CTGTGAGGGAGCAGGGAACAGGG + Intergenic
1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG + Intronic
1144288458 17:13802654-13802676 CTGAGAAGGAGGAGGAAGAGAGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144727033 17:17507203-17507225 CTGCCAGGGAGGAGGGAGGGAGG + Intronic
1144778209 17:17795398-17795420 GGGTGAAGGAGGAGGCAGGTGGG + Exonic
1144781178 17:17809492-17809514 CTGTGAAGGAGGTGCGAGGTGGG - Intronic
1145391189 17:22456893-22456915 CTTTGAAGGAGGAGGGGTTAGGG - Intergenic
1145934163 17:28705359-28705381 GCTTGAAGGAGAAGGGAGGAGGG - Intronic
1145969576 17:28949298-28949320 CCGGGAGGGAGGAGGGAAGAGGG + Intronic
1145994984 17:29099934-29099956 CTGGGAAGGTTGAGGGAGAAGGG + Intronic
1146217106 17:30986157-30986179 CAGTGAAGGAAAAGGGAGGGGGG - Intronic
1146263891 17:31438504-31438526 CTGTGATGGAAGGGGGAGGCAGG - Intronic
1146299418 17:31676608-31676630 ATGGGAGGAAGGAGGGAGGAGGG + Intergenic
1146884741 17:36463625-36463647 CATTGAGGGTGGAGGGAGGAAGG + Intergenic
1146938453 17:36826923-36826945 CTGTGAAGAGGAGGGGAGGAAGG - Intergenic
1146958055 17:36948643-36948665 TTGGGAAGGAGGAGGGAGTAGGG - Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147161497 17:38571888-38571910 CTAGGATGGAGGAGAGAGGAAGG - Intronic
1147252388 17:39160788-39160810 CTGTGAGGCAGTAGGAAGGAAGG - Intronic
1147262384 17:39216079-39216101 ATGTGAAGGATGAGGCATGAGGG - Intronic
1147310858 17:39595505-39595527 GAGGGAAGGAGGAGGGATGAAGG + Intergenic
1147368015 17:39972106-39972128 CTGTGAAGGGCAAGGGAGGGAGG - Intronic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147458355 17:40552748-40552770 CTGTGGAGGAGCAGGGAGAGAGG - Intergenic
1147583240 17:41638491-41638513 CTGGGAAGGTGGAGGGTGGGAGG - Intergenic
1147669972 17:42171239-42171261 CTGGGAAGGGGCAGAGAGGATGG + Intronic
1148072206 17:44915016-44915038 CTGTGAGGCAGAAGTGAGGAGGG - Exonic
1148109567 17:45136953-45136975 CAGGGCAGGAGCAGGGAGGAAGG + Intronic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148467570 17:47874057-47874079 GAGGGAAGGAGGAGGGAGGAAGG - Intergenic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148749088 17:49934564-49934586 CTGTGGTGGAGCAGGTAGGAAGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149286955 17:55175838-55175860 CTCTAAAGCAGAAGGGAGGATGG - Intergenic
1149304428 17:55334604-55334626 CTGGGAAGGGGGTGAGAGGAAGG + Intergenic
1149416857 17:56468830-56468852 GTGTGAAGGAGGTGGGGGCAGGG + Intronic
1149673942 17:58441938-58441960 GTGTGAGTGAGGGGGGAGGATGG + Intronic
1149679868 17:58498528-58498550 CGGGGGAGGAGGGGGGAGGAGGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1151071296 17:71215723-71215745 CCGTGAAGAAGGAGAGAGAAAGG + Intergenic
1151276548 17:73038773-73038795 GAGGGAGGGAGGAGGGAGGAGGG + Intronic
1151325398 17:73376863-73376885 GGGTGAAGGAGGAGGAAGGAAGG - Intronic
1151393138 17:73801382-73801404 CTCTGCCGGAGGAGGGAGAAGGG + Intergenic
1151418737 17:73983842-73983864 CTATTAAGGAGGAGCGAGGAAGG + Intergenic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1151495068 17:74454022-74454044 CAGTGAAGGTGGGGGGAGGTGGG + Intergenic
1151599488 17:75097528-75097550 CTGGGAAGGTGGTGGGAGGGTGG + Intronic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1151824980 17:76519178-76519200 GTGGGAGGGAGGATGGAGGAGGG - Intergenic
1151860837 17:76760374-76760396 TTGAGAAGGAGGAGGAGGGAGGG + Intronic
1152005122 17:77675814-77675836 CTCAGATGGAGGAGGGAGGAAGG - Intergenic
1152112968 17:78367319-78367341 CCGGCAAGGGGGAGGGAGGAAGG - Intergenic
1152124553 17:78438432-78438454 AGGAGGAGGAGGAGGGAGGAGGG + Intronic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152243032 17:79170101-79170123 CAGGAAAGGAGGAGGAAGGAAGG + Intronic
1152423268 17:80205283-80205305 GAGGGAAGGAGGAGGGAGGAAGG - Intronic
1152617079 17:81342945-81342967 CTGAGAAGGGGGCGGAAGGAAGG - Intergenic
1152637492 17:81436118-81436140 CAGGGAAGGAGGAGGGAGTGGGG - Intronic
1152811851 17:82386113-82386135 CGGGGAAGGCGGAGGCAGGATGG - Intergenic
1152811912 17:82386322-82386344 AGGGGAAGGCGGAGGGAGGACGG - Intergenic
1152811966 17:82386513-82386535 AGGGGAAGGCGGAGGGAGGATGG - Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1152913076 17:83016603-83016625 CTGAAGAGGAGGGGGGAGGAGGG + Intronic
1153054700 18:934486-934508 CTGTGAGGGAGGCTGGAAGAGGG + Intergenic
1153060658 18:991569-991591 CAGGGAAGGAGGAAGAAGGAAGG - Intergenic
1153073260 18:1131530-1131552 GTGTGTAGGAGGATGGAGGGAGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153700792 18:7691863-7691885 AGGTTAAGGAGGTGGGAGGATGG + Intronic
1153700802 18:7691898-7691920 AGGTTAAGGAGGTGGGAGGATGG + Intronic
1153700812 18:7691933-7691955 AGGTTAAGGAGGTGGGAGGATGG + Intronic
1153835851 18:8963063-8963085 GAGTGAAGGAGAAGGGAGGGAGG + Intergenic
1153991802 18:10406821-10406843 CTATGATGGAAGAGGCAGGAGGG - Intergenic
1154041430 18:10859858-10859880 CTGTGCTGGAGGAGAGGGGAGGG + Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154261560 18:12838550-12838572 CTGGGAGGCAGTAGGGAGGAGGG + Intronic
1154332239 18:13439716-13439738 GGGTGCAGGAAGAGGGAGGAAGG + Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155066535 18:22273761-22273783 TGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1155608924 18:27640784-27640806 CTGTGAATGGGATGGGAGGAGGG + Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1156009912 18:32484900-32484922 CTGAGAAGGAGGAGGAAGAAAGG + Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156327725 18:36089334-36089356 CTCTGGAGGATGAGGCAGGAGGG + Intergenic
1156783461 18:40880732-40880754 CAGAGAAGGAGGTGGGGGGAGGG - Intergenic
1156885939 18:42136028-42136050 CTGTGAATGAGGAGGAGGGCTGG + Intergenic
1156921033 18:42522583-42522605 CTCAGAAGAAGGAGGCAGGAAGG + Intergenic
1156961630 18:43039012-43039034 CAGTGAAGGAAAAGGTAGGAAGG - Intronic
1157253224 18:46114784-46114806 CTGGAAGGGAGGAGGGAGGGAGG + Intronic
1157293097 18:46423892-46423914 CAGTGAAGAAGGAGGAACGAGGG - Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157505550 18:48223592-48223614 GTGTGTAGGAGGGGTGAGGATGG + Intronic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157583089 18:48784576-48784598 CTCTGCAGCAGGATGGAGGAGGG + Intronic
1157605609 18:48924203-48924225 CTGGGAAGGAGGCGGGAGGGAGG + Intronic
1157612672 18:48968222-48968244 GGGTGAAGGAGGATGCAGGAAGG - Intergenic
1157662103 18:49454446-49454468 CTGTAAAGGAGCAGACAGGATGG + Intronic
1157810776 18:50694271-50694293 ACGTGCATGAGGAGGGAGGATGG - Intronic
1157856213 18:51107956-51107978 CTGCGTAGGAGAAGGGAGAAGGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158058722 18:53312983-53313005 GAGGGAGGGAGGAGGGAGGAAGG + Intronic
1158081845 18:53601750-53601772 TTGTGAAGTAGAAGAGAGGAAGG + Intergenic
1158208517 18:55021161-55021183 ATGTGAAGTGGGAGGGAGGTAGG - Intergenic
1158240042 18:55367342-55367364 GTTTGCAGAAGGAGGGAGGATGG - Intronic
1158277437 18:55783162-55783184 CACTGAAGTAGGAGAGAGGATGG - Intergenic
1158300543 18:56047239-56047261 GAGGGATGGAGGAGGGAGGAAGG - Intergenic
1158435493 18:57432977-57432999 GAGTGAGGGAGGAGGGAGGGAGG + Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1158876993 18:61743286-61743308 CTGTAAGGGAGGAAGGAGGTGGG - Intergenic
1158877725 18:61749153-61749175 CAGTCAAGGAGCAAGGAGGAAGG - Intergenic
1158992673 18:62886008-62886030 CTGTGAAGCTGGAGAAAGGAAGG + Intronic
1159050543 18:63417484-63417506 CTGAGAAGGAGGAGCCAGAATGG - Intronic
1159823221 18:73173083-73173105 CGGTGAAGGAGGCGGGAGAGGGG + Intronic
1159890014 18:73944129-73944151 TGGGGAAGGAGGTGGGAGGATGG - Intergenic
1159915932 18:74187686-74187708 GTGGCAAGGAGGAGAGAGGAAGG - Intergenic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160356086 18:78229524-78229546 AAGGGAGGGAGGAGGGAGGAAGG - Intergenic
1160448604 18:78946910-78946932 TGGTGAAAGATGAGGGAGGAGGG + Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1160709496 19:544535-544557 CAGTGAGGGAGAAGGGAGGTGGG + Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160872076 19:1282206-1282228 GGGGGAAGGAGGGGGGAGGAGGG + Intergenic
1160922434 19:1527164-1527186 GTGTGAGGGAGGACGGGGGAGGG + Intronic
1160931694 19:1573566-1573588 CTGTGATGGAGAAGGAAGGCAGG + Intergenic
1160963882 19:1737112-1737134 TTGTGCAGGCGGAGGTAGGAGGG - Intergenic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161046099 19:2135873-2135895 CTGGGAGGGAGGAGGGTGGAGGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161268180 19:3374857-3374879 CTGGGGAGGACAAGGGAGGATGG + Intronic
1161269692 19:3383004-3383026 GTCTGAGGGAGGAGGCAGGAAGG + Intronic
1161273681 19:3404131-3404153 CTGTGACGGGGGGGGGAGAAGGG - Intronic
1161374644 19:3933297-3933319 CTGGCCAGGAGGAGGGAAGAGGG + Intronic
1161393093 19:4031500-4031522 CTTTGAGGGAAGAGGGAGGTGGG - Intronic
1161404075 19:4082046-4082068 GCATGGAGGAGGAGGGAGGAGGG - Intergenic
1161654827 19:5507746-5507768 CTGGGGTGGAGGGGGGAGGACGG + Intergenic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161790713 19:6358177-6358199 CTGGGATTGAGGAGGTAGGAGGG - Intergenic
1161918716 19:7250258-7250280 ATGGGAAGGAGGAGAGGGGAAGG + Intronic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1161989029 19:7673485-7673507 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1162075432 19:8183681-8183703 TTGTCAAGGAGAAGGAAGGAAGG + Intronic
1162583575 19:11545482-11545504 CAGGGAAGGTGGAGGGAGGGGGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1162851067 19:13431304-13431326 CTGTGAAGGTGGTGAGAGGTGGG + Intronic
1162979349 19:14228602-14228624 GTGGGCAGGAGGATGGAGGATGG + Intergenic
1163000219 19:14362489-14362511 CGGGGAAGGAGAAGGAAGGAAGG + Intergenic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163148984 19:15400101-15400123 CTGGGAAGGAGGAGGAAGAGTGG + Intronic
1163153031 19:15425836-15425858 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1163426486 19:17243622-17243644 TTGTGCTGGAGGAGGGAGCAAGG + Intronic
1163618020 19:18341058-18341080 CTCGGAAGGGGCAGGGAGGAAGG - Intronic
1163758951 19:19122665-19122687 CTGTGAAGGCTGAGGTGGGAAGG + Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164050691 19:21583884-21583906 CTGTCCTGGAGGAGGGAGAAAGG + Intergenic
1164698303 19:30263092-30263114 CCGAGAAGGAGGTGGGAGGAGGG + Intronic
1164731026 19:30504507-30504529 GGGGGCAGGAGGAGGGAGGAAGG - Intronic
1164732402 19:30516273-30516295 CTGCCCAGGAGGACGGAGGACGG - Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1165876184 19:39008653-39008675 CCAGGGAGGAGGAGGGAGGATGG - Intronic
1166130087 19:40740781-40740803 CTGGGAAGCAGGAGGCAGAATGG + Exonic
1166181274 19:41110847-41110869 CTAGGAAGGAGTAGGAAGGAGGG + Intergenic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166521283 19:43481905-43481927 ATGAGAAGGATTAGGGAGGAGGG + Intronic
1166551040 19:43666477-43666499 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
1166828727 19:45625637-45625659 CTGAGAAGGTGGAGTGAGGCAGG - Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166934143 19:46320956-46320978 GAGTGAAGGAAGAGGGAGAAAGG - Intronic
1167055697 19:47110957-47110979 CTGTGAAGGAGAAAGGGGAAAGG + Intronic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167189959 19:47979162-47979184 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
1167195177 19:48023401-48023423 AAGTGAGGGAGGAGGGAGGGAGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167441706 19:49512914-49512936 GTCTGAGGGAGGAGGGAGGAGGG + Intronic
1167469048 19:49665327-49665349 CTGTCCTGGAGGAGGGAGGCGGG - Exonic
1167554190 19:50183039-50183061 AGGGGAAGGAGGAGGAAGGAAGG - Intergenic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167622125 19:50566405-50566427 CTGGGAAGGGGGAGGGGGAAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167744977 19:51345429-51345451 ATGGGAAGGAGGTGGCAGGAAGG - Intronic
1167747784 19:51362967-51362989 CCATGAAGGAGGTGGGAGCAGGG - Intronic
1167779930 19:51592695-51592717 AGGAGAAGGAGAAGGGAGGAAGG + Intergenic
1168107768 19:54174654-54174676 ATCTGAGGGAGGAGGGAGGTGGG - Intronic
1168107791 19:54174728-54174750 ATCTGAGGGAGGAGGGAGGTGGG - Intronic
1168291562 19:55360050-55360072 GTCTGAGGGAGGAGGGAGCAGGG - Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
1168464864 19:56594523-56594545 AGGAGAGGGAGGAGGGAGGAAGG - Intergenic
925056863 2:863063-863085 AAGAGAAGGTGGAGGGAGGAAGG - Intergenic
925270168 2:2600366-2600388 GGGTGTAGGAGGAGGGAGAAGGG - Intergenic
925410544 2:3637425-3637447 CTGTGATGTAGGAAGGAGGGCGG + Intronic
925654673 2:6133277-6133299 CTGTGACGGAGGGGGAGGGAAGG + Intergenic
925927585 2:8681665-8681687 AGGGGAAGGAGGAGGGAGAAGGG - Intronic
925958836 2:8995957-8995979 CTGTGATGGTGGTGGGAGGTGGG + Intronic
926085391 2:10016584-10016606 GTGAGTAGGAGGAGGGAGGGTGG + Intergenic
926238035 2:11063527-11063549 CTGTCATGGAGGCAGGAGGAGGG + Intergenic
926266864 2:11330943-11330965 GGGGGAGGGAGGAGGGAGGAGGG + Intronic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
926846965 2:17152044-17152066 CAGTGATGGAGGAGGGATGGTGG + Intergenic
927513314 2:23658077-23658099 AGGAGAGGGAGGAGGGAGGAGGG - Intronic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928226171 2:29450073-29450095 CTGTCAAGGAGGGAGCAGGAAGG - Intronic
928626089 2:33141578-33141600 CTGAGAAGGGGGATGGAGAATGG + Intronic
928747380 2:34431812-34431834 GTGTGAAGGAGAGGGAAGGAAGG + Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
929910952 2:46089178-46089200 ATAAGAATGAGGAGGGAGGAAGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930064510 2:47317407-47317429 ATGAGATGGTGGAGGGAGGAAGG - Intergenic
930152019 2:48068896-48068918 CTGAGAAGGAGCAGTGAGGCAGG + Intergenic
930752190 2:54945021-54945043 GAGTGAAGGAGGAGGGAAGGAGG - Intronic
931090459 2:58880549-58880571 CAGGGAAGGAGGAAGGAAGAAGG + Intergenic
931692533 2:64847453-64847475 CCAGGCAGGAGGAGGGAGGAAGG + Intergenic
931790128 2:65657579-65657601 GTGTGAAGGTGGGGAGAGGAGGG - Intergenic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932585095 2:73022632-73022654 GGGGGAAGGGGGAGGGAGGAGGG + Intronic
932616294 2:73233658-73233680 CCGTGAAGGCGTGGGGAGGAGGG - Intronic
932687741 2:73887475-73887497 TTGTGGAGGAGGCGGGAGGCGGG - Intergenic
932708845 2:74047554-74047576 CTCTGAAGGAGCAGGGAAGGAGG - Exonic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
932788471 2:74630479-74630501 CCGTTGAGGAGGCGGGAGGAGGG - Intronic
933206526 2:79513305-79513327 TTGGGAAGGATGAGGGAGGGAGG - Intronic
933276797 2:80292470-80292492 CTCTGAACGAGGAGGGATGAAGG + Intronic
933449194 2:82424747-82424769 CTTTGAAGTTGGAGGAAGGAGGG + Intergenic
933572009 2:84025093-84025115 CTCTGAAGATGGAGGAAGGAGGG + Intergenic
933679118 2:85083319-85083341 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
934606599 2:95699830-95699852 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
934655774 2:96116328-96116350 CGGTGGAGGAGGATGTAGGAGGG - Intergenic
935028623 2:99301435-99301457 GTGAGAAGGGGAAGGGAGGAAGG + Intronic
935029364 2:99307070-99307092 GTGAGAAGGGGAAGGGAGGAAGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935924101 2:108048468-108048490 GAGTGAAGGTGGAGGGAGGGTGG - Intergenic
936153750 2:110035501-110035523 GTGGGGAGGAGGAGGGAGGGGGG - Intergenic
936190935 2:110335914-110335936 GTGGGGAGGAGGAGGGAGGGGGG + Intergenic
936476999 2:112848122-112848144 AAAGGAAGGAGGAGGGAGGAGGG - Intergenic
936540003 2:113341958-113341980 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
937072727 2:119076412-119076434 GTGGGAAGGATGAGGCAGGAGGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937151445 2:119689119-119689141 CTGTGAAGGACAAAGAAGGAGGG - Intergenic
937239395 2:120450600-120450622 CTGTGAACCAGGTGGGAGGGAGG - Intergenic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937639658 2:124197221-124197243 CTGCAAAGGTGGAGGAAGGAGGG - Intronic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
937873964 2:126806297-126806319 CTGAGAAAGAGGAGCCAGGAGGG - Intergenic
937983109 2:127626439-127626461 CCCTTTAGGAGGAGGGAGGAAGG - Intronic
938100180 2:128493124-128493146 CTGGGCAGGAGCAGGGTGGACGG - Intergenic
938181574 2:129189497-129189519 GGGTGAAGGAGAAGGGAAGAAGG + Intergenic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938589430 2:132722448-132722470 CTGTGAAGGAAGAGGAGGGCTGG - Intronic
939081568 2:137668893-137668915 CTGAGGAGGAGGAGGAAGAAAGG + Intronic
939570280 2:143832486-143832508 GGGTGAAGGAGGAGGGAAGGTGG + Intergenic
939589456 2:144045776-144045798 GTGTGCAGGAAGAGAGAGGAAGG + Intronic
939956963 2:148535279-148535301 CCATGAAGGAGGAAGGAGGAAGG - Intergenic
940596040 2:155794803-155794825 CAGGGAAGCAGGAGAGAGGATGG + Intergenic
940769144 2:157821736-157821758 CTGTGCAGGTGGTTGGAGGATGG + Intronic
941166761 2:162091238-162091260 CAGTGAAGGAGATGGGAGCAGGG - Intergenic
941718301 2:168786833-168786855 CTCTGGAGGAGGGGGGAGGCAGG - Intronic
941960642 2:171250055-171250077 TTGGGAATGAGGTGGGAGGATGG + Intergenic
942455587 2:176136284-176136306 CAGAGAAAGAGAAGGGAGGAAGG + Intergenic
942507356 2:176657069-176657091 GGGAGGAGGAGGAGGGAGGAAGG + Intergenic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942803204 2:179899541-179899563 TTGTGAAGCAGGAGGGTGGTTGG + Intergenic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
943041532 2:182811064-182811086 CGGTCAAGGAGGAGGGGGCATGG - Intergenic
943445875 2:187987348-187987370 CTGTTAAGGAGGAGAAAAGAGGG + Intergenic
943532647 2:189103726-189103748 AGGTGAAGGAGGGGAGAGGAGGG + Intronic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
943665325 2:190602874-190602896 GTGGGAAGGAAGAGGGAGCAAGG + Intergenic
943993532 2:194730165-194730187 GTTGGAAGGTGGAGGGAGGAAGG + Intergenic
944427218 2:199595622-199595644 CTGTCCAGGAAGAGAGAGGAGGG + Intergenic
944450165 2:199834459-199834481 CTAAGAAGGAAGAGGGAGGCAGG - Intronic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944677904 2:202049422-202049444 AGGTGAAGGGGAAGGGAGGAGGG + Intergenic
944939553 2:204608731-204608753 ATATGCAGGAGCAGGGAGGAGGG - Intronic
945983450 2:216334936-216334958 CTGTGAGGGATGATGTAGGAAGG + Intronic
946010940 2:216563025-216563047 GTGTGAGGGAGGTGGGAGGTGGG + Intronic
946159247 2:217826064-217826086 CTGGGAAGGAGAAAGGAGGTGGG - Intronic
946160104 2:217830680-217830702 CTCTGAGGAAGGAAGGAGGATGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946393156 2:219428796-219428818 CTGGGATGGAGGAGGAGGGATGG + Intergenic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
946438297 2:219674079-219674101 CCAGGAAGGAGGAGGGACGATGG - Intergenic
946459560 2:219856947-219856969 CTGGCAAGGAGTAGGGGGGATGG + Intergenic
946750864 2:222895320-222895342 CTCTGGAGGAGGAGAGAGGGTGG - Intronic
947030082 2:225783115-225783137 GGATGAGGGAGGAGGGAGGAAGG - Intergenic
947119370 2:226799654-226799676 AGGAGGAGGAGGAGGGAGGAGGG - Exonic
947232455 2:227902044-227902066 CTGTTGAGGAGGGGTGAGGATGG + Intronic
947634636 2:231673730-231673752 CAGGGAAGCAGGAGGGAGGTGGG - Intergenic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
948049937 2:234972463-234972485 TAGAGATGGAGGAGGGAGGAGGG + Intronic
948187252 2:236031213-236031235 CTAAGAAGGAGGGAGGAGGAAGG + Intronic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948355713 2:237375324-237375346 CTGGCAATGAGGATGGAGGATGG + Intronic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
948577638 2:238964962-238964984 TGGGGAAGGAGGAGGGCGGAAGG - Intergenic
948703073 2:239772851-239772873 GAGGAAAGGAGGAGGGAGGATGG - Intronic
948720833 2:239899069-239899091 GTGTGATGGAGGAGTGTGGAGGG + Intronic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948893186 2:240916763-240916785 CTGAGCAGGCGGAGGGAGGGCGG + Intergenic
948917544 2:241043072-241043094 CTGCGAAGGAGGATGGAGATGGG + Intronic
949057205 2:241934618-241934640 CTGTGAAGTTGGCGGGGGGATGG + Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169673734 20:8132208-8132230 GGGGGGAGGAGGAGGGAGGAGGG + Intronic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1170948045 20:20909630-20909652 CTTTGAAGGATGAGGGGGAATGG + Intergenic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171147247 20:22795628-22795650 TCGTGAAGGAGGAGAGAGGTGGG + Intergenic
1171501088 20:25593843-25593865 CTGTGAAGGAGGCTGGGTGAAGG - Intergenic
1171849651 20:30299514-30299536 CTGTGGAGGAGCTGGGAGGTGGG - Intergenic
1171958285 20:31475862-31475884 CTGAGGAGGAAGAGGCAGGAGGG - Intronic
1172063977 20:32206888-32206910 ATGGGAAGGAAGAGCGAGGATGG + Intronic
1172109872 20:32538490-32538512 CCATGAAGGAGGAGGGAGGGAGG - Intronic
1172169008 20:32917591-32917613 CTGGGAAGCAGGAGGGATGATGG + Intronic
1172292205 20:33784320-33784342 ATGGGAAGGAGGAGGGAGAAGGG - Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172740719 20:37164359-37164381 AAGAGAAGGAGGAGGGAGGGAGG - Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172778606 20:37422764-37422786 GGAGGAAGGAGGAGGGAGGAAGG - Intergenic
1172800548 20:37573446-37573468 CAGAGAAGGAGTAGGGAGGTGGG + Intergenic
1172858735 20:38030222-38030244 GAGGGAGGGAGGAGGGAGGAAGG + Intronic
1173159001 20:40638693-40638715 TTCTGAAGGCGGAGGGAAGAGGG + Intergenic
1173273596 20:41558703-41558725 CTGAGAAGGGGGAGAGAGGGTGG - Intronic
1173541682 20:43857346-43857368 GAGAGAGGGAGGAGGGAGGAAGG + Intergenic
1173578846 20:44132322-44132344 CTGTGAATGAGGTGGAAGGGAGG + Intronic
1173605518 20:44328208-44328230 ATGTGGAGGAGGGGGGAAGATGG - Intergenic
1173925560 20:46778705-46778727 CTTTGCAGGAAGAGGGAGGGAGG - Intergenic
1174006618 20:47416032-47416054 GAATGAAGGAGGAAGGAGGAAGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174112463 20:48205895-48205917 CAGAGAAGGAGGGAGGAGGAGGG - Intergenic
1174168773 20:48603624-48603646 CAGAGAAGGAGGGAGGAGGAGGG + Intergenic
1174502593 20:50996638-50996660 CTGTAAAGGAGGAGGGAGGCAGG + Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174883652 20:54307810-54307832 CTGTGAAGAGGGAGGGATGCAGG - Intergenic
1174975528 20:55328853-55328875 CTGAGAAGATGGAGGGAGGGAGG - Intergenic
1175116947 20:56689416-56689438 GTGGGAGGGAGGAGGGAGGCAGG + Intergenic
1175118961 20:56703644-56703666 CTGTGGAGGAGCTGGGAGGGTGG + Intergenic
1175224908 20:57439293-57439315 CAGTGCAGGAGGAGGGGGGGTGG - Intergenic
1175272204 20:57742266-57742288 CTGTGAAGGAAAGGGGAGGTGGG + Intergenic
1175315200 20:58042411-58042433 GAGTGAAGCAGGAGAGAGGAGGG - Intergenic
1175640003 20:60620978-60621000 CTGTGAGGGGGAATGGAGGAAGG + Intergenic
1175667722 20:60874302-60874324 CTGAAAGGGAGGAGGCAGGATGG + Intergenic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176095778 20:63343713-63343735 CTGGGAAGGAGGGGGCAGGATGG + Intronic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1176270372 20:64233102-64233124 AGGGGAAGGAGGAGGGAAGAAGG - Intronic
1176612494 21:8996503-8996525 CTGTGATGGAGCAGGGAGCAGGG + Intergenic
1176712629 21:10166969-10166991 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1177047421 21:16187436-16187458 CTGGGAAGGAAGAGGAAGAATGG - Intergenic
1178000431 21:28156463-28156485 CTGAGGAGGAGGAGGAAGAAAGG - Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178489755 21:33041923-33041945 CTGGGAAGGAGTATGGAGCAGGG + Intergenic
1178719815 21:34998413-34998435 CTGAGGAGGAGGATGAAGGATGG - Intronic
1178982145 21:37273571-37273593 TGGAGAAGGAGGAGGGGGGAGGG + Intergenic
1179084983 21:38207958-38207980 GAGTGGAGGAGGAGAGAGGAGGG - Intronic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1179116703 21:38499832-38499854 ATGGGAGGAAGGAGGGAGGAAGG + Intronic
1179164853 21:38927358-38927380 CTTTGAAGATGGAGGAAGGAAGG - Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179421236 21:41238391-41238413 GTATGCAGGAGGAGGGAGGCAGG + Intronic
1179888592 21:44324993-44325015 CTGGGCAGGAGAAGGCAGGAGGG + Intronic
1179896102 21:44364591-44364613 CTGGGAGGGAGTAGGGAGGAAGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180586060 22:16892352-16892374 CTGTCAAGGGGGTGGGAGGCTGG - Intergenic
1180800621 22:18630268-18630290 CTTTGGAGGAGGAGGAAGGGTGG - Intergenic
1180851853 22:19025825-19025847 CTTTGGAGGAGGAGGAAGGGTGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181221098 22:21364994-21365016 CTTTGGAGGAGGAGGAAGGGTGG + Intergenic
1181382868 22:22520856-22520878 TAGTGAAGGAGGAGGGAGGAGGG - Intergenic
1181459512 22:23077958-23077980 CTGGGCAGGAGGAGGCATGAGGG - Intronic
1182019026 22:27065446-27065468 CTTTTAAGGAGGAAGGAGGCAGG - Intergenic
1182070844 22:27462589-27462611 CTGCGCAGGAGGGGGCAGGAAGG + Intergenic
1182082445 22:27538892-27538914 CAGGGAAGGAGGAAGGGGGAGGG - Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1182741073 22:32567884-32567906 AAGAGAAGGAGGAGGGAGGCAGG - Intronic
1182901106 22:33898867-33898889 CAGGGAATGAGGAGGCAGGAGGG - Intronic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1183069778 22:35387896-35387918 TTCTGAAGGGGGAGGGTGGAAGG - Intronic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183199535 22:36376344-36376366 CCTGGGAGGAGGAGGGAGGATGG - Intronic
1183279034 22:36922434-36922456 ATGTGCAGGAGGAGGGAAGCGGG - Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183344098 22:37297492-37297514 CTGGGAGGGGGAAGGGAGGAAGG - Intronic
1183467870 22:37988927-37988949 CTGGGAAGGTGGAGGGCCGACGG + Intronic
1183724009 22:39578493-39578515 CAGGGGAGGAGGAGGGAGGGTGG - Intronic
1183762150 22:39831386-39831408 CTGTTAAGCAGGAAGGAGAAAGG + Intronic
1183852375 22:40601321-40601343 CTCTGAAGGCGGAGGCAGGGAGG - Intronic
1183936518 22:41265530-41265552 TCGTGCAGGAGGAGGGAGGGAGG + Intronic
1183976031 22:41512915-41512937 CTGGGATGGAGGTGGGGGGAAGG - Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184665892 22:45988875-45988897 CTTTGAGGGAGGAGGAGGGAAGG + Intergenic
1184781565 22:46652219-46652241 CTGAGAAGGAGATGGCAGGAAGG + Intronic
1184809993 22:46824769-46824791 GTGTGAAGGATGAGGGAAGGAGG + Intronic
1184895283 22:47403069-47403091 GTGTGACAGAGGAGGCAGGAGGG + Intergenic
1184965249 22:47966660-47966682 CTGTGGAGGAGAAGGAAGGCGGG - Intergenic
1185028534 22:48429472-48429494 GGGAGAAAGAGGAGGGAGGAAGG + Intergenic
1185110135 22:48896206-48896228 GGGTGAGGGAGGAGGGAGGATGG + Intergenic
1185129097 22:49027527-49027549 CAGTGAAGGGGCAGTGAGGAGGG - Intergenic
1185169440 22:49284114-49284136 CCAGGAATGAGGAGGGAGGAAGG + Intergenic
1185172047 22:49299830-49299852 CTCTGACGGAGGAGGGAAGGAGG + Intergenic
949362868 3:3250109-3250131 CTGTCAAGGAGCTGGGAAGAGGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949549862 3:5104051-5104073 GGGGGAAGGAGGGGGGAGGAGGG - Intergenic
949576479 3:5343405-5343427 ATTTGAAGGGGGAGGAAGGAGGG + Intergenic
949901443 3:8818134-8818156 CTGCGAATGAGGAGGAGGGAAGG - Intronic
950001919 3:9663315-9663337 TTGGGAAAGAGGAGGAAGGAAGG + Intronic
950085547 3:10254984-10255006 GTGGGAAGGAGGAAGGGGGAAGG - Intronic
950153265 3:10704568-10704590 ACGGGAAGGAGGAGGGAGCAGGG - Intronic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952113256 3:30148963-30148985 CTGTGATGGAAGTGGGAGGATGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952849148 3:37713482-37713504 CACAGAGGGAGGAGGGAGGAGGG + Intronic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953375603 3:42425924-42425946 CTCTGCAGGAGGAGAGAGGTAGG - Intergenic
953389963 3:42528213-42528235 GTGGGAGGGAAGAGGGAGGAGGG - Intronic
953583537 3:44178714-44178736 TTGGGAAGGTGGAGGGTGGAAGG - Intergenic
953651197 3:44806526-44806548 CTGAGAATGAGGAGAGAGAAAGG + Intronic
953721539 3:45360130-45360152 CTTTGAAGAATGAGGTAGGAAGG + Intergenic
953858348 3:46519532-46519554 CTGTGAAGGGAGAGAGAAGAGGG - Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954150493 3:48654836-48654858 GTGTGTGGGAGGAGGGAGTATGG + Intronic
954363498 3:50134545-50134567 GTGGGAAGGGTGAGGGAGGAGGG + Intergenic
954392504 3:50274989-50275011 CTGAGAGGGAGGAGGGGCGACGG - Intronic
954519617 3:51213069-51213091 CTAGGAATGGGGAGGGAGGAGGG - Intronic
954635411 3:52068382-52068404 TTGTGGAGGAGGAGGAAGAAAGG + Intergenic
954758932 3:52860353-52860375 CTGTCAATGAGGAGGTATGAAGG + Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
954839618 3:53498938-53498960 CTGAGAACGAGGAGGGAGCTCGG + Intronic
954876525 3:53806187-53806209 AGATGAGGGAGGAGGGAGGAGGG - Intronic
954907862 3:54077945-54077967 CAGTGAAGGAGAGGGAAGGAAGG + Intergenic
955294840 3:57725468-57725490 CTGGGAAGGGGGAGGGGGAATGG - Intergenic
955395889 3:58556909-58556931 CAGGGAAGGAGGAAGGGGGAAGG + Intergenic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
956166003 3:66398704-66398726 CTGCGCAGCAGGAGGGGGGAGGG + Intronic
956178079 3:66493077-66493099 CCTTGAGGGAGGAGGGAGGAGGG - Intronic
956693629 3:71900504-71900526 CTGGGAAGGAGGAGGAAGAGAGG - Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956716202 3:72082270-72082292 CTGTGATGGATGACGGAGAACGG - Intergenic
956719803 3:72107800-72107822 GGGTGAAGGAGCAGGCAGGAAGG + Intergenic
956749328 3:72333721-72333743 CTCCAAAGGAGGAGGGAGAAGGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958915887 3:100049663-100049685 CTGAGAAGGAGGAGGAAGAAGGG - Intronic
959133902 3:102392558-102392580 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
960101453 3:113746958-113746980 CTGGGATGGAGGAGGCAGGGCGG + Intergenic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
960948643 3:122984130-122984152 CAGTGAAGGAGAAGAGAAGAAGG - Intronic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961340114 3:126212250-126212272 GAGAGAAGAAGGAGGGAGGAAGG + Intergenic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961456913 3:127028931-127028953 CTGTGATGGAGGAGGGAAAGAGG + Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
961578159 3:127855497-127855519 CAGAGAAGGAGGTGTGAGGATGG - Intergenic
961617565 3:128194982-128195004 CCAAGAAGGAGGAGCGAGGAGGG - Intronic
961644437 3:128385110-128385132 CTCTGGAGGAGGAGGGAGCTGGG - Intronic
961721130 3:128896968-128896990 AAGTGAAGCAGGATGGAGGATGG - Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
961962852 3:130869734-130869756 CTGTGAAGGTTGAGAGAGGAGGG + Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962946029 3:140171479-140171501 TTTTGAAGGATGAGGCAGGAAGG + Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
964004687 3:151813024-151813046 GCGAGAAGGAGGAGGGAAGAAGG - Intergenic
964276080 3:155010461-155010483 CAGTGAAGGAAGGGTGAGGAAGG - Intergenic
964428284 3:156576329-156576351 ATGGGAAGGAAGAGGGAGGGAGG + Intergenic
964441720 3:156718173-156718195 CTGAGGAGGAGGAGGAAGGGGGG + Intergenic
964563963 3:158029403-158029425 CTGGGAAGGAAGAGGGAGGGAGG + Intergenic
964896556 3:161603602-161603624 GGGGGAGGGAGGAGGGAGGAGGG - Intergenic
964979680 3:162664521-162664543 GAGTGTAGGAGGTGGGAGGAGGG + Intergenic
965079539 3:164019675-164019697 GTGAGAAGGAGGAGGGAAGAGGG + Intergenic
965734139 3:171803104-171803126 CTGTGATGGAGAAGGAGGGAAGG + Intronic
965855266 3:173080500-173080522 GTGTGATGGCGGAGAGAGGAAGG + Intronic
966043226 3:175518013-175518035 CTGGAAAGGAGGAGAGAAGATGG + Intronic
966087357 3:176084743-176084765 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
966521913 3:180882416-180882438 AGGAGAAGGAGGAAGGAGGAAGG - Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966872360 3:184299262-184299284 CGGAGATGGAGGAGGGAGGCCGG + Exonic
966929532 3:184666869-184666891 CAGAGAAGGAGGCTGGAGGAGGG + Intronic
966944132 3:184765774-184765796 CAGCGAGGGAGGAGGGAGGTAGG + Intergenic
967019104 3:185506910-185506932 GTGAGAAGGAGGAGGAAGGATGG + Exonic
967023115 3:185540144-185540166 GTGTGAAGGATAAAGGAGGAGGG - Intronic
967323250 3:188214609-188214631 CTTTGAAGCAAGTGGGAGGAGGG + Intronic
967401598 3:189068804-189068826 GAGGGAGGGAGGAGGGAGGAGGG + Intronic
967439038 3:189485645-189485667 CTAAGAAAGAGGAGGGAGGGTGG - Intergenic
967506295 3:190256360-190256382 CTTTGAAGGAGAAGGAAGAAAGG + Intergenic
968646526 4:1743923-1743945 CTGCGACAGAGGAGTGAGGATGG + Intronic
968728988 4:2261066-2261088 CTTTTAAGGGGGCGGGAGGAGGG - Intronic
968826457 4:2901292-2901314 GTGTGAGGGAGGAGAGAGGGGGG + Intronic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969652582 4:8476655-8476677 GTCTCATGGAGGAGGGAGGAAGG - Intronic
969757055 4:9156911-9156933 TTGTGCAGCAGGAGGGGGGACGG - Intergenic
969817014 4:9694486-9694508 TTGTGCAGCAGGAGGGGGGACGG - Intergenic
970512877 4:16798602-16798624 GTGTGAGGGAAGAGGGAGGTGGG - Intronic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
970607244 4:17692196-17692218 AAGTGAAGGAGGAGGGAGTGAGG + Intronic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
972169213 4:36324277-36324299 AGTTGAAGGAGGAAGGAGGAGGG - Intronic
972233279 4:37099853-37099875 CTATGAAGGTGGAGGAAGGGGGG + Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972285927 4:37648234-37648256 CTGGGAAGGAGGAGAGGGGGAGG + Intronic
972292312 4:37700763-37700785 CAGTGAAGGAGAAGTGTGGAGGG - Intergenic
973076894 4:45940369-45940391 AAGGGAGGGAGGAGGGAGGAAGG + Intergenic
973113639 4:46427575-46427597 AGGGAAAGGAGGAGGGAGGAAGG - Intronic
973260482 4:48158788-48158810 CTCAGAAGGAGGAGGAAAGAAGG + Intronic
973345167 4:49047356-49047378 CTATGCTGGTGGAGGGAGGATGG + Intronic
973570241 4:52231405-52231427 CAGTGAAGGTGGAGGATGGATGG + Intergenic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974382602 4:61160642-61160664 CATTGATGGAGGAGGGCGGAGGG + Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
974953000 4:68604212-68604234 CTGTAAAGTAGCAGGGAGGGAGG + Intronic
975114696 4:70666920-70666942 AAGTGAAGGAGGAGAGATGAAGG + Intronic
975234199 4:71972308-71972330 CTCTGAATGAGTAGGGAGGTAGG + Intergenic
975479190 4:74858771-74858793 GTGTGAAGGTGTAGGGAGGTTGG - Intergenic
975528136 4:75373654-75373676 CTGTAGGGGAGGAGGGAGGGAGG - Intergenic
975773395 4:77755719-77755741 ATGTGAAGGAGTGGGGAAGAAGG + Intronic
975834218 4:78404634-78404656 CTGTGAAGGATGACAGAGGAAGG - Intronic
975978464 4:80126858-80126880 CTAGAAAGGAGGAGGAAGGAAGG - Intergenic
976050273 4:81003837-81003859 GGGTGATGGAGGAGGGAGGGAGG + Intergenic
976217556 4:82729331-82729353 TTCTGGAGGAGGAGGGAGGCTGG + Intronic
976244089 4:82990143-82990165 TTCTGAAGGAGGAAGGATGAGGG - Intronic
976343757 4:83975520-83975542 CTGTGAAGGAGTAGGAGGTAGGG - Intergenic
976446856 4:85139889-85139911 GGGGGAGGGAGGAGGGAGGAGGG + Intergenic
976512530 4:85928300-85928322 GAGGGAAGGAGGAGGGAGGAAGG - Intronic
976753877 4:88477583-88477605 AAGGGAAGGAGGAGGGAGGGAGG + Intronic
977577593 4:98691436-98691458 TTGTGTAGGAGGTGGGAGGGTGG - Intergenic
977600238 4:98928278-98928300 CTGTCATGGAGGAGGGAAGGGGG - Intronic
977637538 4:99317002-99317024 CTGTTATGGTGGAGGGAGTAGGG + Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
977700079 4:100011926-100011948 CTGTGATTGAGGTGGTAGGAGGG - Intergenic
977791714 4:101112740-101112762 CTGTGAAGGATGATAGTGGAGGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978131811 4:105207467-105207489 CATTGAAGGAGAAAGGAGGAGGG + Intronic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
978234701 4:106444858-106444880 GTGTGAAGGTGGTGGGAGGTGGG + Intergenic
978705089 4:111698444-111698466 GTGGGAGGGAGGGGGGAGGAAGG + Intergenic
979336868 4:119473226-119473248 CTGTGAAGGAACAGTGATGATGG - Intergenic
979535334 4:121813190-121813212 GTGGGAAGGAAGGGGGAGGAAGG - Intronic
980190682 4:129520494-129520516 AAGAGAAGGAGGAGGGAGGGGGG + Intergenic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
981067237 4:140498094-140498116 CGGGAAAGGAGGCGGGAGGAGGG + Intronic
981196678 4:141929175-141929197 CTGTGATGGAGGAGAGAGTCTGG - Intergenic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981900383 4:149855272-149855294 CTGTGATGGAGGAGAGAGTTTGG - Intergenic
982201392 4:152964462-152964484 CTGTTCAGGAGGTGAGAGGAAGG - Intronic
982233854 4:153233737-153233759 CTATGAAGTAGAAGGAAGGATGG + Intronic
983089107 4:163483451-163483473 TTGAGAAGAAGGAGTGAGGAAGG + Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983608073 4:169612665-169612687 CTGGGAAGGAGCAGTGAGGCTGG + Intronic
984884801 4:184440697-184440719 CTGTGAAGCTGGAGGCAGGGAGG - Intronic
985068313 4:186144618-186144640 CCGGGAAGGAGTAGGGAGGCCGG + Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985140970 4:186840498-186840520 AGGAGAAGGAGGCGGGAGGAAGG - Intergenic
985214613 4:187637634-187637656 AAGAGAGGGAGGAGGGAGGACGG - Intergenic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
985446526 4:190023818-190023840 GAGAGAAGGAGGAGGGAGGGAGG - Intergenic
985572152 5:652798-652820 TTGGGAAGGAGGAGGCAGGTGGG + Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986078046 5:4358150-4358172 CTGTTAAGGAGGAAGGAGTTAGG + Intergenic
986221996 5:5776358-5776380 GGATGCAGGAGGAGGGAGGAGGG + Intergenic
986390881 5:7287240-7287262 AAGTCAAGGAGGAAGGAGGAGGG - Intergenic
986705083 5:10447931-10447953 TTGTGAAGTGGCAGGGAGGAGGG + Intronic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
986773502 5:10994340-10994362 CGGGGAAGGAGGAGGGGGGCGGG + Intronic
986831818 5:11588876-11588898 CAGGGAGGGAGGAGGGAGGTGGG - Intronic
988303844 5:29468979-29469001 TTGTAAAGGAGGAGTGATGATGG - Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989323155 5:40160303-40160325 CTGAGAAGGAGGAGGAAAGGAGG + Intergenic
989704454 5:44311902-44311924 CTGTGAAGGAATAGGAAAGAAGG - Intronic
989713126 5:44425422-44425444 CTGAGATGGAGAAGGGTGGAAGG - Intergenic
990382714 5:55232550-55232572 CCGGGAAGGAGGGGGGAGGCGGG + Intronic
990558478 5:56960635-56960657 CGGAGATGGAGGAGGGAGAAGGG - Intronic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
990663164 5:58041762-58041784 CTGAGAAGGAGCAGGGAGCCAGG + Intergenic
991180247 5:63742645-63742667 ATGTGCAGCAAGAGGGAGGATGG - Intergenic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
992966143 5:82002638-82002660 ATGTGAAGGTGGAGGGAGAGAGG + Intronic
993139178 5:84008707-84008729 GTGAGTAGGAGGTGGGAGGAAGG + Intronic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
993478873 5:88397798-88397820 CTGTGAAGGAGCGTGCAGGACGG - Intergenic
993532546 5:89042141-89042163 CTGTGCAGGAGGTGGGCAGATGG + Intergenic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
994157094 5:96515747-96515769 CTCTTCAGGAGCAGGGAGGAAGG - Intergenic
994504177 5:100619384-100619406 CAATGAAGGAGAAGGAAGGAAGG - Intergenic
994731025 5:103490613-103490635 GAGGGAAGGAGGAGGGAGAAAGG - Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995714311 5:115067184-115067206 CTGAGAAGGAGGAGGAATAAAGG + Intergenic
995797541 5:115957742-115957764 CTGTGAAGTAGGAGGCAAGGGGG + Intergenic
996001771 5:118372747-118372769 TTCTTAATGAGGAGGGAGGAAGG - Intergenic
996168795 5:120262608-120262630 CTTTAAAGGAGAAGGAAGGAAGG - Intergenic
996344150 5:122471690-122471712 CTCTGAAGGATAAAGGAGGAGGG - Intergenic
996636375 5:125694034-125694056 CTGTGAAGGAGGAAAGAATATGG - Intergenic
996653046 5:125904713-125904735 CTATGAAGGAGAAAGGAGAATGG + Intergenic
996845881 5:127898566-127898588 GTGAGAAGGAGGGAGGAGGAAGG + Intergenic
997195609 5:131977225-131977247 CTGCCAAGGAGCAGGCAGGAAGG - Intronic
997381159 5:133439553-133439575 CTCTGAAGCAGGAGGGATGAAGG - Intronic
997441095 5:133909064-133909086 CAGTGAAGGAGGTTGCAGGAAGG + Intergenic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997646529 5:135485880-135485902 CTGTGATGGAGCAATGAGGAGGG + Intergenic
997748839 5:136325452-136325474 CCTATAAGGAGGAGGGAGGAAGG - Intronic
997823840 5:137089055-137089077 CTGAGCAGGAGAATGGAGGAGGG + Intronic
997883427 5:137610940-137610962 GTGTTAGGGAGGAAGGAGGAAGG - Intergenic
998104784 5:139461632-139461654 CTGTCATGGAGGGGGTAGGAGGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998376595 5:141694905-141694927 GTGTGAAGGAGAAGGAGGGAAGG + Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998490160 5:142539584-142539606 AGGAGAAGGAGGAGGGAGGGAGG - Intergenic
998658083 5:144204984-144205006 CCGTGAACGAGGAGGGGGGAGGG + Intronic
998742561 5:145221428-145221450 CTGTGAAGGATGAGGTTGGAAGG + Intergenic
998898025 5:146821019-146821041 CTGTCAAGGAGGCGGAATGATGG - Intronic
998985430 5:147751509-147751531 ATGTGAAGGGGGTGGGGGGAGGG - Intronic
999198045 5:149796167-149796189 GTGTGACGGAGTAGGGAGGGTGG + Intronic
999236211 5:150097318-150097340 AGGGGAAGGAGAAGGGAGGAAGG + Intronic
999265218 5:150262537-150262559 ATGTGCAGGAGAAGTGAGGATGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999575411 5:152971234-152971256 CTCAGAAGGAGGAGGGTGGGAGG + Intergenic
1000012868 5:157249087-157249109 CTCAGAAGGATGAGGCAGGAGGG + Intronic
1000132128 5:158310074-158310096 GAGGGAAGGGGGAGGGAGGAAGG - Intergenic
1000157982 5:158570602-158570624 CAGTGAAGTAGGGGTGAGGAAGG - Intergenic
1000503135 5:162077922-162077944 GAGGAAAGGAGGAGGGAGGAAGG + Intronic
1000829394 5:166084299-166084321 GTGTGAAGGAGAAAGGAAGAAGG - Intergenic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001050268 5:168408486-168408508 CTCTGAAGGAGGGGAGAGCAGGG - Exonic
1001052799 5:168426391-168426413 CTGTTAGGGAGGGGAGAGGAGGG - Intronic
1001214915 5:169846848-169846870 CTCAGAAGGGGGAGGGTGGAAGG - Intronic
1001485995 5:172120041-172120063 ATGTGGAGGCGGTGGGAGGAGGG + Intronic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1001700697 5:173704816-173704838 CAATGAAGGAGGCTGGAGGAAGG + Intergenic
1001779649 5:174356855-174356877 ATGTGAGGGAGGGGGTAGGAAGG + Intergenic
1001814905 5:174660401-174660423 CTGGGAAGGAGGTGGGGGCAGGG - Intergenic
1001853529 5:174990517-174990539 CAGTAATGGAGGAGAGAGGATGG + Intergenic
1001897414 5:175393278-175393300 CTGTGATGGAGGTGGGGTGAGGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002065910 5:176651546-176651568 CGGGGAAGGATGAGGGGGGAGGG + Intronic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002304972 5:178277907-178277929 GGGTGAGGGAGGATGGAGGATGG + Intronic
1002394547 5:178942540-178942562 CTCAGAAGGAGGAGAGAGAATGG + Intronic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002625102 5:180521178-180521200 GTGTGAAAGAGGAGGAAAGAGGG + Intronic
1002701756 5:181129788-181129810 AGGTGAAGGAGCAGGAAGGAGGG - Intergenic
1002778689 6:349883-349905 CTGGCAAGGAGCAGAGAGGAGGG - Exonic
1002888793 6:1317033-1317055 CTGGGGGGGAGGCGGGAGGAGGG - Intergenic
1002966432 6:1970798-1970820 CTGTCAGGGAGGTGGAAGGAGGG + Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003020533 6:2505220-2505242 CAGTGACGGGGGAGTGAGGAGGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1004019056 6:11759908-11759930 CTTTGAAGGAGGAGGAGGAAAGG + Intronic
1004163927 6:13239044-13239066 CTGTGGAGGAGCAGGGAGTGGGG + Intronic
1004167564 6:13270389-13270411 CTGGGAAGCAGGAGGGTGGGGGG - Intronic
1004377892 6:15106483-15106505 TTCAGGAGGAGGAGGGAGGATGG + Intergenic
1004744834 6:18499441-18499463 CTGAGAAGGAGGAGGGAAGGTGG + Intergenic
1004925079 6:20408582-20408604 CTTTGAAGGAGAAGTGATGAAGG + Intronic
1004945582 6:20609256-20609278 AGGAGAAGGAGGAGGAAGGAAGG - Intronic
1005105745 6:22222727-22222749 GGGGAAAGGAGGAGGGAGGAAGG - Intergenic
1005140090 6:22621866-22621888 CTGAGAATGAGGTGGGTGGAGGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006187711 6:32190182-32190204 GAGAGAGGGAGGAGGGAGGAGGG + Exonic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1006582039 6:35082845-35082867 CCGAGAAGGAGCAGGGAGGCCGG - Intronic
1006670550 6:35727583-35727605 CTGTGAAGGATCAGGGAAGGGGG + Intronic
1006990076 6:38207734-38207756 CTCTGAAGGAAAAGGTAGGAGGG + Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007941893 6:45789283-45789305 CTGGGAAGGGGAAGGGAGAATGG - Intergenic
1008200895 6:48588684-48588706 CAATGAAGGAGAAGGGAGTATGG + Intergenic
1009198488 6:60715768-60715790 ACTAGAAGGAGGAGGGAGGAAGG + Intergenic
1010037556 6:71343914-71343936 CTGTGAAGGGTAAAGGAGGAGGG + Intergenic
1011153650 6:84303940-84303962 GTGGGAAGTTGGAGGGAGGAGGG + Intergenic
1011187755 6:84697762-84697784 AAGTGAGGGAGGAGGAAGGAGGG + Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011566496 6:88679033-88679055 CTGAGAAGGAGGAGGAAGAGGGG - Intronic
1012095589 6:94954615-94954637 GTCAGAAGGGGGAGGGAGGAGGG + Intergenic
1012271234 6:97214736-97214758 CTCTTAAGGAGGAGGTGGGATGG - Intronic
1012943153 6:105438513-105438535 GTGAGAGGGAGGAGGGAGGAAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013567562 6:111382785-111382807 CTGTGAAGGTTGGGGGAGGGGGG - Intronic
1013713257 6:112926692-112926714 CTGTGAGGGAGTAGGGAGACAGG - Intergenic
1014034921 6:116755393-116755415 CTGTGAAGGCTGAGAGAGGTGGG + Intronic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1014340336 6:120197647-120197669 TTGAGGAGGAGGAGGGATGATGG - Intergenic
1014953860 6:127592933-127592955 CTTTGAAGGGGGAGGGGGAATGG + Intergenic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1015414264 6:132930885-132930907 CTGAGCAGCAGGAGGGAGGGTGG + Intergenic
1015539683 6:134301247-134301269 GTGTGGAGGAGGAGGGAGAGTGG + Intronic
1015688838 6:135897294-135897316 GTGTGTAGGCGGAGGAAGGAGGG + Intronic
1015843003 6:137493312-137493334 CTGCCAAGGAGGAGGGAGAGCGG - Exonic
1016073083 6:139764043-139764065 CTGTGGAGGAGTAGGCTGGAAGG - Intergenic
1016439327 6:144067286-144067308 GTGAGAGCGAGGAGGGAGGAGGG + Intergenic
1016445630 6:144129267-144129289 ACTTGAAGGAGGAGGGTGGAAGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017096906 6:150812720-150812742 CAGGGAAGGAGGAGGAAGGTGGG + Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017258912 6:152364664-152364686 GAGGGAAGGAGGAAGGAGGAAGG + Intronic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017637366 6:156456204-156456226 ATGGGGAGGAGGGGGGAGGAAGG - Intergenic
1017637462 6:156456391-156456413 ATGGGGAGGAGGGGGGAGGAGGG - Intergenic
1017730006 6:157306645-157306667 CTGTGAAGGAGAAGAGATGAGGG + Intronic
1018063182 6:160106227-160106249 GCGTGGAGGAGGAGGGAGGCCGG + Exonic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018322908 6:162632493-162632515 ATGAGAAGGAGGAGGGAGGGAGG + Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018768853 6:166955681-166955703 CTGGGAAGGAGTAGGGGGTAGGG - Intronic
1018807752 6:167274372-167274394 TTAGGCAGGAGGAGGGAGGACGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018905986 6:168076149-168076171 CTGTGACGGAGGGTGCAGGACGG + Intronic
1018915903 6:168132194-168132216 CTGAGAAGGAGGCAGGAAGAAGG - Intergenic
1018985909 6:168636983-168637005 GAGTGAGGGAGGCGGGAGGAGGG - Intronic
1019151741 6:170010979-170011001 GAGGGAAGGAGGAGGGAGGGAGG + Intergenic
1019334881 7:478383-478405 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334974 7:478677-478699 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334980 7:478695-478717 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334986 7:478713-478735 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334992 7:478731-478753 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335002 7:478760-478782 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335022 7:478816-478838 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335028 7:478834-478856 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335038 7:478863-478885 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335054 7:478908-478930 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335060 7:478926-478948 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335080 7:478982-479004 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335086 7:479000-479022 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335096 7:479029-479051 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335116 7:479085-479107 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335122 7:479103-479125 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335132 7:479132-479154 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335148 7:479177-479199 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335154 7:479195-479217 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335169 7:479237-479259 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019930504 7:4219822-4219844 ATATGAAGGAGGAGCGGGGAGGG - Intronic
1020887314 7:13834052-13834074 GTGTGAAGGAGAAGGGAACACGG + Intergenic
1020917117 7:14208423-14208445 GTTTGAAGTAGGAGGCAGGAAGG + Intronic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1021239050 7:18178086-18178108 CTGTCAAAGAGGAGAGGGGAGGG - Intronic
1021265515 7:18516495-18516517 ATGTGAAGGAGGTGAGAGGAAGG - Intronic
1021514868 7:21473107-21473129 GTGTGAAGGATGAGAAAGGAGGG + Intronic
1021717159 7:23470559-23470581 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
1021763951 7:23928372-23928394 TTGTGAAGGAGGAGTGCGGAGGG + Intergenic
1022027738 7:26464633-26464655 GTGTGAAGGAGGAGGAGGGGAGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022505554 7:30907035-30907057 TTGTGAAGGAGGGGTCAGGAGGG + Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022977808 7:35575009-35575031 ATCTGCAGGTGGAGGGAGGACGG - Intergenic
1023068480 7:36403407-36403429 CTGTGAAGGATAAGCCAGGAAGG + Intronic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1023654921 7:42409604-42409626 CAGTGAAGGAGAAGGCAGGAAGG - Intergenic
1023821010 7:43980503-43980525 TTCTGAAGGAAGAGGCAGGAGGG + Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024024826 7:45401196-45401218 CAGTGCAGGAGGATGGTGGAGGG + Intergenic
1024213987 7:47231135-47231157 CAGCCAAGGAGGAGGGAGAAGGG + Intergenic
1024511836 7:50210725-50210747 ATTTGAAGGAGGTGGGAGGATGG + Intergenic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024677252 7:51647775-51647797 ATGAGGAGGAGGAGGAAGGAGGG - Intergenic
1024752112 7:52478593-52478615 CTGTTAAAGAGAAGGGAAGATGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1026191916 7:68136516-68136538 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026191924 7:68136535-68136557 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026203628 7:68236555-68236577 CTGAGATGCAGGAGAGAGGAGGG + Intergenic
1026211893 7:68313154-68313176 CAGGGAATGAGGAGTGAGGAAGG + Intergenic
1026614178 7:71887080-71887102 GTGTGAAGGTGTAAGGAGGATGG + Intronic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1026869575 7:73842206-73842228 CTCTGAAGGGGGAGGAGGGAAGG - Intronic
1026896482 7:74012849-74012871 CTGTGAATGAGGTGTGAGGAAGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027328288 7:77065071-77065093 TTCTGAAGGAAGAGGCAGGAGGG - Intergenic
1027522675 7:79229939-79229961 CTGTGAGGGTGGGGGGAGGGGGG - Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028519323 7:91712312-91712334 ATGGGAAGGAGGAAGAAGGAAGG + Intronic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1029109726 7:98206825-98206847 CTGTGAAGGGGGATGGACAAGGG + Exonic
1029144998 7:98439571-98439593 GGAGGAAGGAGGAGGGAGGAAGG - Intergenic
1029145000 7:98439578-98439600 GAGGGAAGGAGGAAGGAGGAGGG - Intergenic
1029445075 7:100607429-100607451 CTAGGAGGGAGGAGGGTGGAGGG - Intronic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029595953 7:101537788-101537810 GGGTGGAGGAGGAGGGAGCAGGG - Intronic
1029631579 7:101754467-101754489 GTGTGTAGGAGGAGGGAACATGG - Intergenic
1029730696 7:102436019-102436041 GTGTGATGGAGGAGGGAGGACGG + Intronic
1029749283 7:102533942-102533964 TTCTGAAGGAAGAGGCAGGAGGG + Intergenic
1029767226 7:102633046-102633068 TTCTGAAGGAAGAGGCAGGAGGG + Intronic
1029989885 7:104953364-104953386 CTTGGGAGGAGGTGGGAGGATGG - Intergenic
1030034953 7:105401049-105401071 CAGTGACTGAGGAGAGAGGAGGG - Intergenic
1030680419 7:112428049-112428071 TTTAGAAGGAGGAGGGATGAGGG + Intronic
1031051559 7:116950633-116950655 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031614365 7:123863981-123864003 CAGTGAAGAAGGTGGCAGGAGGG - Intronic
1031839255 7:126717428-126717450 GTGTGAAGGAGGGTGAAGGATGG - Intronic
1032071051 7:128807254-128807276 CTGAGAAGGACAAGGGAAGATGG + Intronic
1032339117 7:131054534-131054556 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
1032752991 7:134861071-134861093 CTGGGAAGGAGGAAGAAGCATGG + Intronic
1032987654 7:137356655-137356677 CTGTCCAGGTGGTGGGAGGAGGG - Intergenic
1033137642 7:138798217-138798239 CTGGGAAGGGGGAGGGAAGGAGG + Intronic
1033535484 7:142308283-142308305 CCGGGAAGGAGCAGGGAGGGAGG + Intergenic
1034313956 7:150112634-150112656 CCTTGATGGAGGAGGGAGGGAGG - Intergenic
1034427530 7:151022194-151022216 CTGGGAGGGAGGAGGGTGTAGGG + Intronic
1034448132 7:151123692-151123714 CTGCCCAGGAGGAGGGAGGCAGG + Intronic
1034792940 7:153988158-153988180 CCTTGACGGAGGAGGGAGGGAGG + Intronic
1034975734 7:155448478-155448500 AGGTGAAGGAGCAGGGAGCAGGG + Intergenic
1034997468 7:155587217-155587239 CAGTGATGGAGATGGGAGGAAGG - Intergenic
1035070168 7:156138622-156138644 TGCTGATGGAGGAGGGAGGAAGG + Intergenic
1035141541 7:156767254-156767276 TTGTGAAGGACCAGGTAGGATGG - Intronic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035284176 7:157795741-157795763 CTGTGGACGAGGCGGGAGGCGGG + Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035545372 8:478187-478209 CTGGGCAGGAGGGGAGAGGAGGG - Intergenic
1035587275 8:785862-785884 GGGTGAGGGAGGAGGGAGGCCGG - Intergenic
1035769476 8:2135537-2135559 CTGTGACGGGGTAGGTAGGAAGG - Intronic
1035770385 8:2142618-2142640 CTGCAAGGGAGGAGGGAGGGAGG - Intronic
1035774540 8:2177998-2178020 GTGGGCGGGAGGAGGGAGGAGGG + Intergenic
1036389233 8:8310218-8310240 GGGTGATGGAGGTGGGAGGATGG + Intergenic
1036515364 8:9438730-9438752 CTGTAAAGGAGAAGGGAAGGTGG + Intergenic
1036578369 8:10049988-10050010 CTATGGAGGTGGAGGGAGGGAGG + Intergenic
1036630533 8:10511147-10511169 CCGTGTAGGAGGTGGGAGGAGGG - Intergenic
1037090792 8:14915533-14915555 CTGACAAAGAGGAGGGAAGATGG - Intronic
1037147005 8:15584708-15584730 TGGTGAAGGAGGAGGGTGAATGG + Intronic
1037399307 8:18477756-18477778 ATCTGAAGGAAGAGGAAGGAAGG + Intergenic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037622160 8:20574052-20574074 CTGTGAAGAAAAAGGAAGGAGGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037990625 8:23319271-23319293 CTGTGATGGGGGCGGGAGGGTGG + Intronic
1038150948 8:24942114-24942136 GGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1038232412 8:25714785-25714807 AAGGGAAGGAGGAGGAAGGAAGG - Intergenic
1038311502 8:26449330-26449352 GTGCGGAGGAGGGGGGAGGACGG + Intronic
1038311603 8:26449650-26449672 GTGAGCAGGAGGAGGGAGGGCGG + Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038342124 8:26695265-26695287 CATTGATTGAGGAGGGAGGAAGG - Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038642276 8:29338099-29338121 TTGGGAGGGAGGAGGGAAGATGG - Intronic
1038983720 8:32786412-32786434 CTGGAAAGGAGAAGGGAAGACGG + Intergenic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039558617 8:38495331-38495353 CGGTGAGGGAGGCGAGAGGAAGG + Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040690958 8:49937865-49937887 CTCAGAAGGAGGAGGGAGGAAGG - Intronic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1040974636 8:53176468-53176490 ATGAGAAGGAGGAGGGTTGATGG + Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041525818 8:58804365-58804387 CTGAGGAGGAGGAGGAAGAAGGG - Intergenic
1041610714 8:59844424-59844446 CTGTGAAGGATGTGGGGTGATGG + Intergenic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042138836 8:65659096-65659118 CTGTGAAGAAGTTTGGAGGAAGG + Intronic
1042157056 8:65855700-65855722 TTGTGAAGCAGTGGGGAGGATGG - Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042517439 8:69674299-69674321 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
1042962851 8:74321444-74321466 CGGCAAAAGAGGAGGGAGGACGG - Intronic
1042965542 8:74348007-74348029 CTCTGAAGCAGGATGGAGGATGG + Intronic
1043005317 8:74811267-74811289 CTGACAAGGAGAAGGGAAGAAGG - Intronic
1043313033 8:78886180-78886202 GTGGGAGGGAGGAGGGAGGGAGG - Intergenic
1043313064 8:78886268-78886290 GTGGGAGGGAGGAGGGAGGGAGG - Intergenic
1043585477 8:81763821-81763843 CTGAGAAGCAGGAAGGAGGGTGG + Intergenic
1045444645 8:102248092-102248114 TTGTCAAGGTGGAGGGTGGAGGG + Intergenic
1045483267 8:102609993-102610015 CAGGGAAGGAGGGGGCAGGAGGG + Intergenic
1045855049 8:106755381-106755403 GTGTACAGGAGGAGAGAGGATGG - Intergenic
1046211553 8:111082631-111082653 CTGTGAATGAGCAGTGTGGAAGG - Intergenic
1047061431 8:121231221-121231243 ATGTGAAGGTAGAGGGATGAAGG + Intergenic
1047152489 8:122279923-122279945 CTGGGAAGGATGGGGGAAGAAGG + Intergenic
1047259198 8:123241076-123241098 CCGTGGAGGAGGAGGGACGGCGG + Intronic
1047309909 8:123683241-123683263 TTGTGGAGGAGGAGAAAGGAGGG + Intronic
1047510097 8:125509280-125509302 TTGATATGGAGGAGGGAGGAGGG + Intergenic
1047786388 8:128157797-128157819 CAGTGAAGGAGCCGGGATGATGG - Intergenic
1047953663 8:129956805-129956827 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
1048120771 8:131579090-131579112 CTGTTAAGAAGGAGGATGGAAGG + Intergenic
1048331045 8:133471010-133471032 CGTGGAAGGAGGAAGGAGGATGG - Intronic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1049013574 8:139904402-139904424 CTCTGAAGGATGAGTCAGGAGGG + Intronic
1049049583 8:140183955-140183977 AGGGGAGGGAGGAGGGAGGAGGG + Intronic
1049083134 8:140457917-140457939 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1049370263 8:142261028-142261050 GAGAGAAAGAGGAGGGAGGAAGG + Intronic
1049402146 8:142433230-142433252 AAGGGAAGGAGGAGAGAGGATGG - Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1050389174 9:5120145-5120167 CTCTGAAGGAGGAAGCAGCAAGG - Intronic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1050780748 9:9331714-9331736 GTGTGAAAGAGGTGGGAGGCAGG - Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051605885 9:18917527-18917549 CTTTGAGGGAGAAGGGAGGATGG - Intergenic
1051823769 9:21196375-21196397 CTGTAATGGAGGAGAAAGGATGG - Intergenic
1051873407 9:21765388-21765410 TGGAGAAGGAGGAGGAAGGAAGG + Intergenic
1052324818 9:27206325-27206347 CTGTAAAGGGTGACGGAGGAAGG - Intronic
1052333650 9:27297568-27297590 GTGAGAAGGAGGATGGAAGAAGG + Intergenic
1052416495 9:28184554-28184576 ATGTAAAGGGGGAGGAAGGAGGG + Intronic
1052764444 9:32626456-32626478 ATGTGAAGAATGGGGGAGGAGGG - Intergenic
1053423843 9:37998203-37998225 CTTGGAGGGAGGAGGGAGGAGGG + Intronic
1053441624 9:38120965-38120987 AGGAGAAGGAGGAGGGAGGAGGG + Intergenic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053649634 9:40152770-40152792 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1053756117 9:41311177-41311199 CTGTGATGGAGCAGGGAGCAGGG + Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054330148 9:63744533-63744555 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1054534947 9:66223434-66223456 CTGTGATGGAGCAGGGAGCAGGG + Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054868563 9:70027630-70027652 CAGTGTAGGGGCAGGGAGGATGG + Intergenic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055026077 9:71723032-71723054 CAGGGGAGGAGGTGGGAGGAAGG + Intronic
1055042966 9:71895220-71895242 CTGTAAATGGGGTGGGAGGAGGG - Intronic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1055687423 9:78791711-78791733 CAGGGAAGCAGGAGGTAGGAAGG + Intergenic
1056024248 9:82476209-82476231 CAGTGAGGGAGGAGAGAGGCAGG - Intergenic
1056034475 9:82588987-82589009 CTGAGCTGGAGGAGGTAGGAAGG + Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056561984 9:87738550-87738572 CTGTCAGGGGGGTGGGAGGAGGG + Intergenic
1056795388 9:89655444-89655466 TTGTGAGGCAGCAGGGAGGAAGG - Intergenic
1056867083 9:90237597-90237619 CTCTGAAGGAGGAGGGGTTAGGG - Intergenic
1057195964 9:93115749-93115771 GGGTGAAGGAGGAGTGAGGGAGG + Intergenic
1057699688 9:97354816-97354838 CTCTGAAGGAGGAGGGGGACAGG - Intronic
1057865577 9:98677786-98677808 CTGTGAAGGTCGAGGCTGGAGGG - Intronic
1057943257 9:99303299-99303321 CTGGGGAGGAGCAGGAAGGATGG + Intergenic
1058606783 9:106731383-106731405 CTGGGAAGGAGGAAAGAGAAAGG + Intergenic
1058668922 9:107344262-107344284 CTGGGACTGAGGAGTGAGGAAGG + Intergenic
1058695600 9:107556619-107556641 CTGAGGAGGAGGAGGAAGCAGGG - Intergenic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1059624952 9:116053472-116053494 CTGAGAATGAGGATGGAGAAAGG - Intergenic
1059745028 9:117191898-117191920 CTCTGAGGGAGTAGGGAGAAAGG + Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060056032 9:120413807-120413829 CGAGGAGGGAGGAGGGAGGAGGG + Intronic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1060807546 9:126587113-126587135 CTGTGAGGGATGGGAGAGGAGGG - Intergenic
1060967677 9:127720884-127720906 GGAGGAAGGAGGAGGGAGGAAGG - Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061297090 9:129682591-129682613 GGGTGAAGCTGGAGGGAGGAGGG + Intronic
1061366900 9:130176940-130176962 AGGAGAAGGAGAAGGGAGGAGGG - Intronic
1061577035 9:131513816-131513838 CAGTCAGGGAGGAAGGAGGAGGG - Intronic
1061580819 9:131534786-131534808 GCTTGAAGGAGGAGGGAGGAGGG - Intergenic
1061624731 9:131835036-131835058 TTGTGCAGGAGGAGCGAGGTGGG - Intergenic
1061737400 9:132670654-132670676 CTGGGGAGGAGGAGGGAGAGGGG + Exonic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1061897682 9:133656942-133656964 CTGGGGAGGAGGTGGCAGGACGG + Intronic
1062004839 9:134233949-134233971 CTCTCCAGGAGGAGGCAGGAGGG - Intergenic
1062038969 9:134395558-134395580 CTCTGGAGGAGAAAGGAGGATGG - Intronic
1062080852 9:134622623-134622645 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080883 9:134622722-134622744 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080914 9:134622823-134622845 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062111359 9:134783744-134783766 GTGGGAAGGAAGGGGGAGGAAGG + Intronic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1062335291 9:136062538-136062560 CGATGAAGGAGCAGGTAGGATGG - Intronic
1062449211 9:136608455-136608477 GAGGGAAGGAGGAGGGAGGGAGG + Intergenic
1062520387 9:136955246-136955268 GTGAGAAGCAGGAGGGAGAAAGG - Intronic
1202797376 9_KI270719v1_random:135959-135981 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1185449521 X:275096-275118 GGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1185499476 X:585715-585737 CAGGGATGGAGGAGGGAGGTGGG - Intergenic
1185713819 X:2325470-2325492 CTGACAAAGAGGAGGGAAGATGG - Intronic
1185915483 X:4029775-4029797 CTTTGCAGGAGGAGAGTGGAAGG + Intergenic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1185931370 X:4207023-4207045 CAGAGCAGGAGGAGGAAGGATGG + Intergenic
1186145761 X:6622038-6622060 AAGGGAAGGAGGAGGGAGAAAGG + Intergenic
1186225971 X:7399517-7399539 TTGTGAAGGAGTAGTGGGGATGG + Intergenic
1186410667 X:9342456-9342478 CGGAGGAGGAGGGGGGAGGAGGG - Intergenic
1186473778 X:9841471-9841493 AAGGGAAGGAGGAGGCAGGAGGG + Intronic
1186540295 X:10393367-10393389 GTGTGAAGGAGGAGAGATCAGGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186826958 X:13350035-13350057 GGATGAAGGAGGAAGGAGGAAGG - Intergenic
1187049115 X:15678647-15678669 GGGTGAAGAAGGAGGGAGGGAGG + Intergenic
1187058159 X:15760402-15760424 TAGTAAAGGAGGAGGGAGGTGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187298253 X:18023664-18023686 CTGTGACGGAGAAGGGAGAAGGG - Intergenic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188768532 X:34125951-34125973 CGGTGTGGGAGGTGGGAGGAAGG + Intergenic
1188850153 X:35122323-35122345 ATATGAAGGATGAGAGAGGAGGG - Intergenic
1188892655 X:35629717-35629739 CTGTTAGGGAGGTGGGAGAAGGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189473678 X:41333383-41333405 GGGGAAAGGAGGAGGGAGGAGGG - Exonic
1189579298 X:42388911-42388933 TTGTGAGGGAGGAGGGAAGTGGG + Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1190060960 X:47211406-47211428 GTGGGAAGGAGGAGGAGGGAGGG - Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190280862 X:48928921-48928943 GTTTGCAGGAAGAGGGAGGAAGG + Intronic
1190335147 X:49257634-49257656 CGGTGAATGGGCAGGGAGGAGGG - Intronic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1190509660 X:51162594-51162616 CAGAGGAGGAGCAGGGAGGAAGG - Intergenic
1190862047 X:54354525-54354547 CTGTCAGGGAGGCGGAAGGAGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191977168 X:66885809-66885831 GTGTGGAGGAGGCGGGAGCAGGG + Intergenic
1192084568 X:68083410-68083432 CTGTGAAGGCTGAGGAAGTAAGG - Intronic
1192173337 X:68870495-68870517 CTGGGAAGGTGGATGGAGGTTGG - Intergenic
1192884443 X:75321987-75322009 CTGAGAAGGGGTAGGGTGGAAGG - Intergenic
1193470941 X:81902564-81902586 CTCAGAAGGGGGAGGGTGGAAGG - Intergenic
1194868894 X:99102479-99102501 CTCTGCTGGAGGAGGGAGAAAGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195141191 X:101961800-101961822 CAGAGAAGCAGGAGGAAGGAAGG + Intergenic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195538302 X:106033950-106033972 TTCTGAAGGAGGTGTGAGGAGGG - Intronic
1195708574 X:107756612-107756634 CTGAGAGGAAGGAGGGAGGGAGG - Intronic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196046096 X:111258061-111258083 CTGGGAAGGAGGATGAAGTAAGG - Intronic
1196911167 X:120485907-120485929 CTGAGAAGGTGGCGGAAGGAGGG + Intergenic
1196913226 X:120505531-120505553 AAGGGAAGGGGGAGGGAGGAAGG - Intergenic
1197038813 X:121909205-121909227 CTTTGAAGGGTGAGGGAGAATGG - Intergenic
1197056075 X:122120930-122120952 CTGTGAAAGAGAAGAGAGGGTGG - Intergenic
1197077556 X:122371402-122371424 CTGGGAAGGTGGAGGGTTGAGGG - Intergenic
1197082730 X:122439390-122439412 CTGTGATGGAGGAGGCAGCAGGG + Intergenic
1197230554 X:123999428-123999450 GAGAGAAGGGGGAGGGAGGAGGG - Intronic
1197230836 X:124002110-124002132 CAGTTACTGAGGAGGGAGGATGG + Intronic
1197720667 X:129742468-129742490 CCCTCTAGGAGGAGGGAGGAGGG + Intronic
1197765464 X:130057005-130057027 CAGTGAAGAAGGCGTGAGGAGGG - Exonic
1198102109 X:133431142-133431164 GTGGGAAGGAGGAGAGAAGAAGG + Intergenic
1199257993 X:145739048-145739070 AGGTGAAGGAGAAGGCAGGAAGG - Intergenic
1199264754 X:145817735-145817757 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1199264762 X:145817753-145817775 AAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1199847633 X:151702491-151702513 CTGTGAGGTAGGGGGAAGGATGG - Exonic
1200031933 X:153303983-153304005 CTCTGAAGGGGAAGGGAGGCGGG - Intergenic
1200141627 X:153905509-153905531 CTGGGAAGGAGTCGGGAAGAGGG - Intronic
1200326727 X:155248372-155248394 CTGAGAAGGAGCAGGCAGGGAGG - Intergenic
1200740410 Y:6847658-6847680 CAGAGAAGGAGAAGGGAGGCAGG - Intergenic
1200978207 Y:9236328-9236350 GAGAGAAGGAAGAGGGAGGAAGG - Intergenic
1200987871 Y:9323738-9323760 CAGCGAGGGAGTAGGGAGGATGG - Intergenic
1201257389 Y:12122490-12122512 TTGCCATGGAGGAGGGAGGATGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1201711882 Y:17001337-17001359 CAGACAAGTAGGAGGGAGGAAGG - Intergenic
1202109124 Y:21403662-21403684 CAGCGAGGGAGTAGGGAGGATGG - Intergenic
1202120150 Y:21512457-21512479 CAGCGAGGGAGTAGGGAGGATGG + Intronic
1202122601 Y:21535998-21536020 CAGCGAGGGAGTAGGGAGGATGG + Intronic
1202156404 Y:21893385-21893407 CAGCGAGGGAGTAGGGAGGATGG - Intronic
1202158852 Y:21916926-21916948 CAGCGAGGGAGTAGGGAGGATGG - Intronic
1202185303 Y:22181841-22181863 CAGCGAGGGAGTAGGGAGGATGG - Intronic
1202206057 Y:22404554-22404576 CAGCGAGGGAGTAGGGAGGATGG + Intronic