ID: 1178418806

View in Genome Browser
Species Human (GRCh38)
Location 21:32426773-32426795
Sequence TTGTCTGAAGGGGTGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178418806_1178418813 24 Left 1178418806 21:32426773-32426795 CCCTCCATCACCCCTTCAGACAA 0: 1
1: 0
2: 0
3: 24
4: 241
Right 1178418813 21:32426820-32426842 TTTTCCTTCTGCCAAACACAGGG 0: 1
1: 1
2: 3
3: 33
4: 434
1178418806_1178418812 23 Left 1178418806 21:32426773-32426795 CCCTCCATCACCCCTTCAGACAA 0: 1
1: 0
2: 0
3: 24
4: 241
Right 1178418812 21:32426819-32426841 TTTTTCCTTCTGCCAAACACAGG 0: 1
1: 0
2: 2
3: 33
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178418806 Original CRISPR TTGTCTGAAGGGGTGATGGA GGG (reversed) Intronic
903137741 1:21320377-21320399 TTGCCTGCAGGGCTCATGGAAGG + Intronic
904250355 1:29219100-29219122 TTGCCTTATGGGGAGATGGAGGG + Intronic
906808798 1:48805540-48805562 TTGTCTGAAGGTGGCATGAAAGG + Intronic
906866059 1:49421432-49421454 TTGTCTGAAAGTGAGATGGAAGG + Intronic
908761397 1:67515504-67515526 ATGGCTGAAGGTGTGATGGCTGG + Intergenic
909482191 1:76138226-76138248 TTTTCAGAAGGGCTTATGGAGGG + Intronic
909892276 1:81022397-81022419 TTTTCTGAATGGGTAATGGAAGG + Intergenic
913499957 1:119462905-119462927 CTCTATGAAGGGGTGATTGATGG + Intergenic
916349897 1:163837179-163837201 GTGTCTGTTGGGGTTATGGATGG - Intergenic
920051606 1:203167888-203167910 TGGGCTCAAGGGGTGCTGGAAGG - Exonic
921374558 1:214460375-214460397 GTGTATGAAAGGGTCATGGAAGG - Intronic
922355056 1:224767431-224767453 TCAGCTGCAGGGGTGATGGAAGG - Intergenic
922782217 1:228262215-228262237 TTGGAAGAAGTGGTGATGGATGG - Intronic
922974206 1:229770097-229770119 GTCTCCGAAGGGGAGATGGAGGG - Intergenic
924320461 1:242843442-242843464 TTGTCTCCAGGGGAGATGGTAGG + Intergenic
1063589047 10:7378350-7378372 ATGTGTGGATGGGTGATGGATGG + Intronic
1063589068 10:7378449-7378471 ATGTGTGGATGGGTGATGGATGG + Intronic
1064110995 10:12538818-12538840 TTATCTGAAGTGGTGGGGGAGGG + Intronic
1065281808 10:24146740-24146762 TTGTCTGCTGTGCTGATGGAAGG + Intronic
1065334823 10:24645913-24645935 TTTTCTGAAGTGGTCAGGGAAGG + Intronic
1065860762 10:29870722-29870744 ATGGATGAATGGGTGATGGATGG - Intergenic
1066714932 10:38276664-38276686 GTGTCTGCAGGTGTGATGGGTGG - Intergenic
1067036102 10:42918634-42918656 TTGTTTGAGGGGTTGACGGAAGG + Intergenic
1069784290 10:70977879-70977901 ATGACTGCAGGGATGATGGATGG + Intergenic
1069797203 10:71061093-71061115 TTGTCTGAGGGGGTGATTATGGG - Intergenic
1070756223 10:78995006-78995028 TTGTCTGAAAGGGGAAGGGACGG - Intergenic
1070756371 10:78995937-78995959 TTGTCTGAAAGGGGAAGGGATGG - Intergenic
1070890401 10:79938739-79938761 CTGTGTGATGGGGTGATGAAAGG + Intronic
1072429157 10:95355916-95355938 TTGTCTGGGGTGGTGGTGGAGGG + Intronic
1074711378 10:116180792-116180814 TTATTTGGAGGGGTGGTGGAGGG - Intronic
1075456934 10:122590986-122591008 GTGTCTGAAGGAGTGAGGAATGG - Intronic
1075888271 10:125921889-125921911 TTCTTTGCAGGGGTGGTGGAAGG - Intronic
1076380690 10:130022924-130022946 TTGTCAGAACGGGGGCTGGATGG + Intergenic
1076435727 10:130440033-130440055 TGGTGTGAAGGGGTGATGGGAGG + Intergenic
1077376373 11:2206745-2206767 TTGCCTGATGGGTTGAGGGAGGG - Intergenic
1083203799 11:61135362-61135384 TTGTCTGGAGGGCTCAGGGAGGG - Intronic
1083285253 11:61654633-61654655 TTCTCTGCAGGGGAGAAGGAGGG - Intergenic
1083891490 11:65597989-65598011 TTGCCTGCTGGGGTGATGCAGGG - Exonic
1086457563 11:86974336-86974358 TTGTGTGAAGAAGTGATGGCTGG + Intergenic
1086932014 11:92704213-92704235 TTAGCTGAGGGGGTGGTGGATGG - Intronic
1088840620 11:113624639-113624661 TTGTCTGAAGGGCCCATGGCTGG + Intergenic
1090350822 11:126106603-126106625 TTGTCTGAGGGGGTAACTGAGGG + Intergenic
1090809305 11:130222628-130222650 CTGGCTGGAGGGGTGAGGGAAGG - Intergenic
1091449994 12:566414-566436 ATGTGTGAAGGTGTGAGGGAAGG - Intronic
1092300933 12:7249512-7249534 TTGTTTGAAGGGCTACTGGAGGG + Intergenic
1095963275 12:47849219-47849241 TTGTATCAATGGGTGATAGATGG + Intronic
1098403555 12:70099602-70099624 TTTTCTGGAGGGGTTAAGGAAGG + Intergenic
1098762960 12:74447934-74447956 TTGTAGGAAGTGGGGATGGAGGG - Intergenic
1101704524 12:107209687-107209709 TTCTCTGAAGGGGGGATGAGAGG + Intergenic
1102426067 12:112845312-112845334 TAAGCTGAAGGCGTGATGGAAGG - Intronic
1104896227 12:132166347-132166369 ATGGATGAATGGGTGATGGATGG - Intergenic
1104896454 12:132167222-132167244 ATGGGTGAATGGGTGATGGATGG - Intergenic
1104964137 12:132501436-132501458 CTGTCAGCAGGGGTGATGGCCGG + Intronic
1107398099 13:40039584-40039606 GTGTCTGAAGGGGTTTTGAAAGG - Intergenic
1108336692 13:49449717-49449739 TTTTCTGGAGGAGAGATGGAAGG - Intronic
1110651006 13:77940817-77940839 ATATTTGAAGGGGAGATGGAAGG + Intergenic
1111069682 13:83148777-83148799 ATGTCTGTAGGGGTGAGAGAAGG + Intergenic
1112430809 13:99348708-99348730 TTGTCTGAAGGGATGACGGTAGG + Intronic
1112647633 13:101353360-101353382 TTGTCTGAAGTGAAGCTGGAAGG - Intronic
1113858945 13:113468606-113468628 TTGTCTGAAGGAGAGGTTGATGG - Intronic
1114179774 14:20356376-20356398 TTGTTTGAAGTGGAGAAGGATGG + Exonic
1119640763 14:76313128-76313150 TTGTCTGACCGTGTGATAGAGGG + Intronic
1119756998 14:77126252-77126274 CTGTCTGAAGGGGTGATTTTAGG - Intronic
1122250953 14:100439271-100439293 TTGTCAGAATGCGTGGTGGATGG + Intronic
1122584610 14:102796520-102796542 GTGTCTGAAGTGGGGATGGGGGG + Intronic
1122747761 14:103909561-103909583 TTGTCTGAAGGGTGGAAGCAGGG + Intergenic
1125280352 15:38036069-38036091 TTTTGTGACTGGGTGATGGAGGG - Intergenic
1126736205 15:51734372-51734394 TTTTCTGAAGTGGTGCTGAAGGG - Intronic
1127350886 15:58150841-58150863 TTGTTTGAAGGGCTCATGGCAGG - Intronic
1127480128 15:59370974-59370996 TTCTCTGCTGGGGTGAGGGAAGG + Intronic
1128449682 15:67798079-67798101 TTGTCTCTGGGGGTGATTGATGG - Intronic
1128732636 15:70031466-70031488 GTGTCTGCAGGGGTGATGCATGG + Intergenic
1129204063 15:74024942-74024964 AGGTCTGAAGGGGTGGTGGTGGG + Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1133832235 16:9333748-9333770 TGTTCAGAAGGCGTGATGGAAGG + Intergenic
1133890781 16:9876776-9876798 TGGTCTGATGGGCTGATGAATGG + Intronic
1134488454 16:14677828-14677850 TTGGATGGATGGGTGATGGATGG + Intronic
1135283164 16:21170616-21170638 TTTTCTAAAGGGGTGAATGACGG - Intronic
1136279615 16:29200462-29200484 TTGCCTCAAGGGGTGGAGGAGGG - Intergenic
1136923582 16:34351072-34351094 ATGTCTGAGGGAGTGCTGGAGGG - Intergenic
1136980991 16:35060734-35060756 ATGTCTGAGGGAGTGCTGGAGGG + Intergenic
1138003908 16:53312468-53312490 TTGTCAGAAGGGGTAAAAGAAGG + Intronic
1139579246 16:67862502-67862524 TTGACTGAAGTGGTGGTGGAAGG - Intronic
1141854881 16:86674058-86674080 TTGGATGAAGGGATGAAGGAAGG - Intergenic
1142084008 16:88166562-88166584 TTGCCTCAAGGGGTGCAGGAGGG - Intergenic
1142499378 17:323809-323831 CTGTCTCGCGGGGTGATGGAGGG - Intronic
1146505071 17:33397706-33397728 TTTGCTGATGGGGTGATGGGAGG - Intronic
1152340196 17:79720211-79720233 TTTACTGAAGGAGTGATGAATGG - Intergenic
1153957904 18:10113673-10113695 TTGGCTGGGGTGGTGATGGATGG + Intergenic
1154957413 18:21272624-21272646 TTGTCTGGAGAGGTCAAGGAAGG - Intronic
1155232228 18:23784670-23784692 GTCGCTGAAGGGGGGATGGAAGG + Intronic
1155249653 18:23942463-23942485 TTGTTTGATGGGTGGATGGATGG + Intronic
1156762893 18:40614676-40614698 ATGTCTGATGGGATGATGGATGG + Intergenic
1157692034 18:49691592-49691614 TTGGCTGGAGGGGTGTGGGATGG + Intergenic
1157749240 18:50163389-50163411 TGGGCTGATGTGGTGATGGAGGG - Intronic
1157918291 18:51691369-51691391 TTGTATAAAGGAGTGATTGAAGG - Intergenic
1158125314 18:54094215-54094237 CTGTCTGGAGTGGTGATGGTTGG + Intergenic
1158155473 18:54421141-54421163 TTATGTGAAGGAGTGAAGGATGG + Intergenic
1161287745 19:3477567-3477589 GTGGGTGAATGGGTGATGGATGG + Intronic
1161657402 19:5524720-5524742 TTGGCTGGATGGGTGAAGGATGG - Intergenic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1161874711 19:6899234-6899256 TTGTCTCAACCGGTGATGGTGGG + Intronic
1166322568 19:42027709-42027731 TCATCTGAAGGTGTGATGGAAGG + Intronic
1166405850 19:42521485-42521507 GTGTCTGAAGGGGAAATGGTGGG + Exonic
1166415008 19:42589002-42589024 GTGTCTGAAGGGGAAATGGTGGG + Exonic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
926965195 2:18402115-18402137 ATGTGGGAAGGGGTGATGGTGGG - Intergenic
927378496 2:22448557-22448579 TTGTAGGAAGGGATGATGAAGGG + Intergenic
927748342 2:25643249-25643271 TGGTCTGAGGAGGTGAAGGAAGG - Intronic
928270706 2:29852348-29852370 GAGTCTGAAGGGGTTAAGGAGGG - Intronic
929967437 2:46545784-46545806 TTCTCTGAGTGGGTGTTGGATGG + Intronic
930325788 2:49915556-49915578 TTGTCTGCTGGGGTGAAGGCAGG + Intergenic
930850343 2:55953137-55953159 TTGTCTGAGGGAGAGAGGGAGGG - Intergenic
932346591 2:70999692-70999714 TTGCCTGAAGGAGGGAAGGAAGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934967277 2:98733462-98733484 TAGTCTGGAGGGGTGATGTAGGG - Intergenic
935274288 2:101463062-101463084 ATGTGTGGATGGGTGATGGACGG - Intronic
936671234 2:114659357-114659379 TTGTAAGAAGGGGTGATAAAAGG + Intronic
936759874 2:115764295-115764317 TTGTCTGAAGGGTAGGTAGATGG + Intronic
936843128 2:116798159-116798181 TTGTATCAAGCGGTGATGGAGGG - Intergenic
936981471 2:118269161-118269183 GTGTCAGAAGGGGAGGTGGACGG + Intergenic
937487579 2:122331820-122331842 TTGCCCGAAGGGGTGAGGGATGG + Intergenic
937672942 2:124558118-124558140 TTAACTGAAGGGGTCAAGGATGG + Intronic
938564342 2:132504549-132504571 TTCCCTGAAGAGGTGATTGAAGG - Intronic
939510473 2:143098585-143098607 TTGTTTGAAGGGCTCATGGCAGG + Intronic
939951713 2:148483292-148483314 TTGTTTGAAGTGCTGTTGGATGG - Exonic
940017406 2:149121659-149121681 TGGGCTGAAGGGGTGGTAGAAGG + Intronic
941589069 2:167395996-167396018 TTCTCTGGAGGGGTGAGGGTAGG - Intergenic
942772324 2:179537008-179537030 TAGTTTGAAAGGGTGAGGGACGG + Intronic
943476644 2:188365770-188365792 TTGCCTGAAGGGGTGAGACAAGG + Intronic
944741538 2:202617504-202617526 TTGTTTGAAGGGCTCATGGCAGG - Intergenic
945379590 2:209123935-209123957 TTGACTTAGGTGGTGATGGAAGG + Intergenic
946414194 2:219531411-219531433 TTGGATGCAGGAGTGATGGAAGG + Intronic
947023423 2:225709766-225709788 TTGTTTGAAGGGATGAGGGAAGG - Intergenic
948376433 2:237523989-237524011 TTGTTTGAAGGGCTCATGGCAGG + Intronic
1169321256 20:4635048-4635070 TTGGGTGCAGGGGTGAGGGAAGG - Intergenic
1169738558 20:8864932-8864954 TTATCTGATGGGAAGATGGAAGG + Intronic
1173005322 20:39135650-39135672 TTGTCTTGAGGGGTTGTGGAAGG + Intergenic
1173303588 20:41826955-41826977 GTCTCTGAAGGGGTGATTAAGGG + Intergenic
1174505431 20:51014801-51014823 TTGGCTGGAGGGGTGAAGGAGGG + Intronic
1177942308 21:27425745-27425767 TTCTCAGAGGGGGAGATGGAAGG + Intergenic
1178418806 21:32426773-32426795 TTGTCTGAAGGGGTGATGGAGGG - Intronic
1178679081 21:34657051-34657073 ATGTGTGGATGGGTGATGGATGG + Intergenic
1178875822 21:36413170-36413192 TTGACAGCAGGAGTGATGGAGGG - Exonic
1179959171 21:44758709-44758731 TTGTCTGGAGGGCACATGGAGGG + Intergenic
1183261377 22:36797968-36797990 TTGTGTGGAGGGGGGATGGGAGG - Intergenic
1183515178 22:38261346-38261368 TTGATTGAAGGGGAGACGGAAGG - Intronic
1184014852 22:41778175-41778197 ATGACAGAAGGGGTGAGGGAGGG + Intronic
1184293343 22:43509478-43509500 ATGTCTGGATGGGGGATGGATGG - Intergenic
1184995943 22:48207699-48207721 TGGTCTTTAGGGCTGATGGATGG + Intergenic
1185052935 22:48563197-48563219 TTGTCTGCAGGGCTCTTGGAGGG - Intronic
949358147 3:3203239-3203261 TTGGATGAGAGGGTGATGGAGGG - Intergenic
950923638 3:16718634-16718656 TTGAATGCAGGTGTGATGGATGG - Intergenic
952534840 3:34298371-34298393 TTGTGGGCAGGGGTGAGGGAAGG - Intergenic
954034773 3:47845558-47845580 TTGGCTGACATGGTGATGGAGGG - Intronic
956022756 3:64949711-64949733 TTGTCTCAGGGAGTGATGCAGGG - Intergenic
956262461 3:67359853-67359875 TTGTCTGAAGATGTGATGGTTGG + Intergenic
956881140 3:73511652-73511674 TTGTCTGCTGGCGTGGTGGACGG - Intronic
958473778 3:94554435-94554457 TTGTGTGGTGGGGTGGTGGAGGG + Intergenic
959449569 3:106482058-106482080 GTGACTGAAGGGTTGAAGGATGG + Intergenic
960026131 3:113012630-113012652 TTTTCTTATGGGGTTATGGAAGG - Intronic
965238533 3:166160875-166160897 TTGTTTGAAGGGCTCATGGCAGG + Intergenic
966226442 3:177603138-177603160 TTGGGTGAAGGGGTTATGGAAGG - Intergenic
966728935 3:183134232-183134254 TTGTATGAGAGGGTGCTGGAGGG + Intronic
967456523 3:189693010-189693032 TTGTTTGAGGGGGTGCTGGCAGG - Intronic
967675188 3:192289903-192289925 TTTTCTGAAGGGTTACTGGAAGG - Intronic
968728114 4:2257574-2257596 TTGTCCGAGGGGCAGATGGAGGG - Intronic
968897621 4:3413944-3413966 TTGACTGAATGGGTGTTGGAGGG + Intronic
970342045 4:15117737-15117759 TTGCCTGAAGGCATGATGAAAGG + Intergenic
971335516 4:25720200-25720222 TTGTTTGAAGGGCTCATGGCAGG + Intergenic
971836066 4:31764165-31764187 CTGTCTGAAGGAGTGAGGGTAGG - Intergenic
972634588 4:40871760-40871782 TTATCTGAAGGGGAGAATGAGGG - Intronic
975118820 4:70706256-70706278 TTGCCTGAAGCGATGAGGGAAGG + Intronic
979994901 4:127420121-127420143 CTGTCTGATGGGGTGGTAGAGGG - Intergenic
982094501 4:151909683-151909705 CTGCCTGGAGGGGTGAGGGAAGG - Intergenic
982442816 4:155456867-155456889 TTGTTTGAAGGGCTCATGGCAGG + Intergenic
983815809 4:172125603-172125625 ATGTCTGAATAAGTGATGGAAGG - Intronic
984189750 4:176591665-176591687 TTGTCTGAATGGGGGATTTATGG - Intergenic
985623542 5:969862-969884 TTGACTGAAGAGTTCATGGAGGG + Intergenic
986065929 5:4233833-4233855 TTTTCCTACGGGGTGATGGAGGG - Intergenic
986350849 5:6878213-6878235 TAGGCAGCAGGGGTGATGGAGGG + Intergenic
987086255 5:14471372-14471394 TTATCCGAAGGGTTGAAGGAAGG - Exonic
989574054 5:42972458-42972480 TTGTCATAAGGGGTGAAAGAGGG + Intergenic
989816246 5:45741191-45741213 TTGACTGTAGGGCTGATTGAAGG - Intergenic
990333358 5:54748747-54748769 TTGCATGAATGGGTGATGCAAGG - Intergenic
990879317 5:60521726-60521748 TAGTGTGAAGGGGTGAGGGAGGG - Intronic
991267524 5:64739359-64739381 TAGTCTGCTGGGGTGATGAAGGG + Intronic
991293029 5:65051059-65051081 GTTTCTGCAGGGCTGATGGATGG + Intergenic
991329909 5:65482837-65482859 TTGTGTGTAGGGGGGAGGGAGGG - Intergenic
995334542 5:110984173-110984195 GCCTCTGAAGGGGTCATGGATGG - Intergenic
996094337 5:119382216-119382238 TTTGCTGATGGGGTGATAGAGGG - Intronic
996184168 5:120456575-120456597 TTGTATGAAGTGGTGAGGGTGGG - Intergenic
996812919 5:127540099-127540121 TTGGCTGAAGGTTTGTTGGATGG + Intronic
996875511 5:128236252-128236274 TTTTCTGAAGGGCTTACGGAGGG + Intergenic
997613424 5:135230706-135230728 TTCTCTGTAAGGGTGTTGGAGGG - Intronic
997758254 5:136420647-136420669 TTTTCTGAAGGGGTCAGGGGTGG - Intergenic
998128948 5:139641517-139641539 TTTGCTGGAGGGGTGAGGGATGG - Intergenic
999722872 5:154411889-154411911 ATCTGTGAAGGGGTGAGGGAAGG + Intronic
1000163693 5:158626509-158626531 CTGGCTGAACGGGTGAGGGAAGG - Intergenic
1000673992 5:164098031-164098053 TTGAATGAAGGGTTGGTGGATGG + Intergenic
1001571455 5:172733033-172733055 TTGTTTCAGGGGGTGATGGTGGG - Intergenic
1002922244 6:1580975-1580997 TTGTCAGAATGGCTGAAGGAGGG + Intergenic
1003420835 6:5957138-5957160 TTGCCTGAGGGTGTGATGGAAGG - Intergenic
1003561341 6:7183362-7183384 TTGTCCAATGGGCTGATGGATGG - Intronic
1004269258 6:14179448-14179470 TTGTCAGCAGGGGTGAAGGGTGG - Intergenic
1007292746 6:40799592-40799614 TTCTCTGAAGGGAAGAGGGAGGG - Intergenic
1007553363 6:42746656-42746678 TTGGGGGAAGGGGTGGTGGAAGG - Intergenic
1012905145 6:105055771-105055793 CTGTCTGAAGGGTGGAGGGAAGG - Intronic
1013359869 6:109383830-109383852 TTCTCTGAAGGGCTTATGGTGGG - Intergenic
1015019414 6:128454112-128454134 TTGGCTGAAGGGGCAAGGGACGG - Intronic
1015525221 6:134169310-134169332 TTGTGTGATGGGATGAGGGAAGG + Exonic
1017252241 6:152293149-152293171 TTTTCTGAAGTGATAATGGAGGG + Intronic
1017892976 6:158654550-158654572 CTTCCTGAAGGGGAGATGGAAGG + Intronic
1018185555 6:161263030-161263052 TGGTCTGATGGGTGGATGGAGGG - Intronic
1018720208 6:166566386-166566408 ATGTCTGAATGAGGGATGGATGG + Intronic
1020756391 7:12209255-12209277 CTGTCTCAAAGGGTTATGGATGG - Intergenic
1022200233 7:28109733-28109755 TTGGCAGAGTGGGTGATGGAAGG - Intronic
1023385706 7:39655404-39655426 GTGTATGGAGGGGAGATGGAGGG + Intronic
1024700211 7:51898743-51898765 TTGTGAGAAGGGGTGATACATGG - Intergenic
1026929678 7:74216943-74216965 GTGAGTGAAGGGGTGAAGGATGG - Intronic
1027288200 7:76672315-76672337 TTTTTTGAGGGGGTGAGGGATGG - Intergenic
1027708101 7:81560156-81560178 CTGTCTGAGGGGGTCAGGGATGG + Intergenic
1029172586 7:98641514-98641536 TTGTCTGTGGGGGTGTTGGGAGG - Intergenic
1029272759 7:99386666-99386688 ATCTCTGAAGGGGAGATGGAGGG - Exonic
1029503190 7:100946495-100946517 TGGACAGAAGGGGTGGTGGATGG + Intergenic
1034113762 7:148563821-148563843 TTGCCTGAAGGGGAGAGGGAGGG + Intergenic
1034399123 7:150849783-150849805 TTGTGGGAAGGGGTTATTGATGG - Intronic
1034678172 7:152907558-152907580 CAGTCAGAAGGGGTGAGGGAGGG - Intergenic
1035490242 7:159270332-159270354 TTGTATGAATGGGTCTTGGAGGG + Intergenic
1037998315 8:23369091-23369113 GGGTCTGAAGGGGTGAGGGCAGG + Intronic
1038049998 8:23799718-23799740 TTATCAGATGGAGTGATGGATGG - Intergenic
1039059736 8:33564179-33564201 GTTTCTGAAGGGGTGAGGGAAGG + Intronic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1045158716 8:99511233-99511255 TTATCTGAAGGCCTAATGGATGG + Exonic
1046783480 8:118240944-118240966 TTGAATGATGGGGTGATAGAGGG - Intronic
1047878486 8:129167033-129167055 TTGTCTGAACTGGTGAGAGATGG + Intergenic
1048137103 8:131757142-131757164 TTGACATAAGAGGTGATGGATGG - Intergenic
1048607099 8:135980465-135980487 GTGTCTGAAGGGGGGAGAGATGG + Intergenic
1050305571 9:4302132-4302154 TGGTCAGCAGGGGTGAGGGAGGG + Intronic
1052658850 9:31402139-31402161 TTGTTTGAAAGGGTGAGGGTTGG - Intergenic
1056790127 9:89619923-89619945 TTCCCTGCAGGGGTGCTGGAAGG + Intergenic
1056900243 9:90592401-90592423 TGGTCAGAAGGGATGAAGGAGGG - Intergenic
1057072364 9:92110388-92110410 TTGTTTGAAGGGCTCATGGCAGG - Intronic
1057181133 9:93031085-93031107 GTGGATGAAGGGATGATGGATGG + Intronic
1058268182 9:102933854-102933876 TGGTTAGAAGGGGTTATGGAGGG - Intergenic
1059856431 9:118403255-118403277 TTGCCTGGATGGATGATGGATGG + Intergenic
1060059669 9:120447927-120447949 CTGGCTGAAGCAGTGATGGAGGG - Exonic
1061373825 9:130212646-130212668 GTGTCTGAAGGAGAGAGGGAGGG + Intronic
1062172252 9:135141403-135141425 ATGGATGAATGGGTGATGGATGG + Intergenic
1187807993 X:23142596-23142618 TTGTAAGAAGGGGTGATTGGCGG + Intergenic
1188453035 X:30329002-30329024 TGGTCTCAGGGGTTGATGGAAGG - Intergenic
1189177038 X:38967975-38967997 TTGTAGTAAGGGGTGATGAAGGG + Intergenic
1189650631 X:43185185-43185207 TTGGCTAAAGGAGTGAAGGAGGG - Intergenic
1190257854 X:48777250-48777272 CTGAGTGAAGGAGTGATGGATGG + Intergenic
1191977783 X:66892924-66892946 TGGTTTTATGGGGTGATGGAGGG + Intergenic
1192191147 X:68991875-68991897 TTGTCTGGAGGGGCTATGGAAGG + Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1192775809 X:74243201-74243223 TTTTCTGATGGGGTAATTGAGGG - Intergenic
1195523019 X:105852248-105852270 TAGTCTGAAGGGAGGATTGAGGG + Intronic
1195926626 X:110032213-110032235 ATGTGTGTTGGGGTGATGGATGG + Intronic
1199092821 X:143711910-143711932 TTGTCTGATGGTGGGAAGGAAGG - Intergenic
1200246053 X:154526423-154526445 TTGGCTTAAGGGGTCCTGGATGG - Intergenic
1200340960 X:155395177-155395199 TAGTGAGAAGGGGGGATGGAAGG - Intergenic
1201458873 Y:14201080-14201102 TTGTAAGGAGGGATGATGGAAGG + Intergenic
1202328163 Y:23714995-23715017 TTGTTTGATGGATTGATGGATGG + Intergenic
1202542607 Y:25955057-25955079 TTGTTTGATGGATTGATGGATGG - Intergenic