ID: 1178422620

View in Genome Browser
Species Human (GRCh38)
Location 21:32454368-32454390
Sequence GGTACTATGTAGTAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178422620_1178422628 18 Left 1178422620 21:32454368-32454390 CCTTCCTTCTACTACATAGTACC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1178422628 21:32454409-32454431 GGTTTAAGTCATTCTTTTTGTGG 0: 1
1: 0
2: 8
3: 117
4: 1683
1178422620_1178422629 22 Left 1178422620 21:32454368-32454390 CCTTCCTTCTACTACATAGTACC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1178422629 21:32454413-32454435 TAAGTCATTCTTTTTGTGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 314
1178422620_1178422626 -3 Left 1178422620 21:32454368-32454390 CCTTCCTTCTACTACATAGTACC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1178422626 21:32454388-32454410 ACCAGGAATTGGGAGAGGTGTGG 0: 1
1: 1
2: 2
3: 65
4: 510
1178422620_1178422625 -8 Left 1178422620 21:32454368-32454390 CCTTCCTTCTACTACATAGTACC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1178422625 21:32454383-32454405 ATAGTACCAGGAATTGGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178422620 Original CRISPR GGTACTATGTAGTAGAAGGA AGG (reversed) Intronic
901850581 1:12012395-12012417 TGAAGGATGTAGTAGAAGGATGG + Exonic
906313936 1:44774187-44774209 GGTCCTAGAGAGTAGAAGGATGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908578887 1:65492425-65492447 GGTACTAGGTATTAGTAGGTGGG + Intronic
911719340 1:101173470-101173492 GGTAGTAGGTAGTAGAGAGAAGG + Intergenic
912031237 1:105247236-105247258 GGAGTTAGGTAGTAGAAGGATGG + Intergenic
912031342 1:105248690-105248712 GGAAATAGGTAGTAGAAGGATGG - Intergenic
914468599 1:147952011-147952033 GGTAGTTTGTAGTAGAGTGAAGG + Intronic
916477836 1:165186617-165186639 GGTGCTAGGCAGTAGAGGGAAGG - Intergenic
920819673 1:209368562-209368584 GGTGGTCTGTAGTAGAAGGAAGG + Intergenic
921571476 1:216784357-216784379 ATTACTATGGAGTAGAATGAAGG - Intronic
923476429 1:234335959-234335981 GGGACTATGTAAAAGAATGATGG + Intergenic
923711471 1:236390901-236390923 GGTGGTAAGTGGTAGAAGGAAGG - Intronic
924072331 1:240294256-240294278 GGTAGTATATATTTGAAGGATGG + Intronic
924919796 1:248616507-248616529 TTTTCTATGTAGTATAAGGAAGG - Intergenic
1066245062 10:33574762-33574784 GGTTCTATGTAGCAGAAGGGGGG - Intergenic
1066439891 10:35428368-35428390 GGTGTTCTGGAGTAGAAGGAAGG + Intronic
1070533516 10:77358463-77358485 GGTGCCATGTATTAGAAGGGAGG - Intronic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1072720769 10:97779752-97779774 GGGAGGAAGTAGTAGAAGGAAGG + Intergenic
1073932420 10:108591042-108591064 GTTACTAGGAACTAGAAGGAAGG + Intergenic
1075420251 10:122295180-122295202 GGAACCAGGTAGAAGAAGGAAGG + Intronic
1079991866 11:27254464-27254486 GGTTCTTTGTAGTAGAAAGTGGG - Intergenic
1080972148 11:37290773-37290795 TGAACTATGTGGTGGAAGGAAGG + Intergenic
1082811634 11:57482395-57482417 GGGACTGTGGGGTAGAAGGAGGG - Intergenic
1083209007 11:61171029-61171051 GATTCTATGGAGTAGGAGGAAGG - Intergenic
1083387973 11:62326212-62326234 GATACCGAGTAGTAGAAGGAAGG - Intergenic
1084524951 11:69690948-69690970 GGTAGGATGGGGTAGAAGGAAGG + Intergenic
1085150447 11:74248540-74248562 GATACAATGTAGTTAAAGGAAGG - Intronic
1085214541 11:74817321-74817343 GTTACTATGAATTAGAAGTAAGG + Intronic
1093597977 12:20984608-20984630 AGTACTATGTTGAAGAGGGATGG + Intergenic
1099440877 12:82698230-82698252 TGTACTGTGTAGTAGAGGCAGGG + Intronic
1103241906 12:119420529-119420551 GGACATAGGTAGTAGAAGGATGG + Intronic
1108278584 13:48838127-48838149 GATATTATGTGGCAGAAGGATGG + Intergenic
1108773481 13:53734151-53734173 GGTACAATGTTGTGGAAGAAAGG + Intergenic
1110354376 13:74550254-74550276 GGAACTATGTAGTAAGAGGTTGG + Intergenic
1110704656 13:78591053-78591075 TGTACTATGTATTAGATGGGAGG - Intergenic
1112117131 13:96368310-96368332 GGAACTTGGTAGTAAAAGGAAGG + Intronic
1113380471 13:109799949-109799971 GGTACAATGGGGTAGAAGAATGG - Intergenic
1115100955 14:29699036-29699058 AATACTATATAATAGAAGGAAGG - Intronic
1116426238 14:44795465-44795487 GGTACTTAGGAGAAGAAGGATGG + Intergenic
1116434783 14:44884959-44884981 GAAAATATGGAGTAGAAGGATGG + Intergenic
1120075589 14:80154114-80154136 GTTACTAAGTAATAGAGGGAAGG - Intergenic
1131609349 15:93944734-93944756 GGACCTAGGGAGTAGAAGGATGG - Intergenic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1145962280 17:28894009-28894031 GATACTGAGTTGTAGAAGGAAGG - Intronic
1147934203 17:44002171-44002193 GAGACTCTGTAGTGGAAGGAGGG - Intronic
1156482113 18:37442877-37442899 GGTACTGTGTAAGAAAAGGAAGG - Intronic
1156854238 18:41763713-41763735 TGTATTATGTAGCAGAAGGTGGG + Intergenic
1167946218 19:52991259-52991281 AGTACTATGTAGGAGAAGCGTGG + Intergenic
925083292 2:1087053-1087075 GGTGCTAAGGAGCAGAAGGAGGG + Intronic
927163603 2:20294348-20294370 GGTATTACTTAATAGAAGGAAGG + Intronic
927353583 2:22147579-22147601 GGTACTATGTAGAATAAGAACGG + Intergenic
927567398 2:24124804-24124826 GCTACTAGGGAGTGGAAGGATGG - Intronic
928117166 2:28554059-28554081 TGTTCTAAGTTGTAGAAGGATGG + Intronic
930308591 2:49708927-49708949 GGCCCTATGTAGATGAAGGATGG - Intergenic
930661242 2:54055679-54055701 GCTATTATGTAGTATATGGAGGG - Intronic
931181021 2:59900759-59900781 GGGACTAGGTAGAAGAAGGCAGG + Intergenic
932259499 2:70315155-70315177 GGTACAATTGAGTAGGAGGAGGG + Intergenic
935169795 2:100602173-100602195 GGTATTTTTTAGTAGAGGGAGGG - Intergenic
935314448 2:101817599-101817621 GGCACTTTGTAGAAGATGGAGGG + Intronic
936489328 2:112956854-112956876 TGTGCTATGTTGTAGGAGGAAGG + Intergenic
936987977 2:118330034-118330056 GGGACAATGGAGTATAAGGAGGG - Intergenic
938187656 2:129246209-129246231 GGTAATAGGTAGTAGCTGGATGG - Intergenic
939702010 2:145403838-145403860 TGTAGTATTTAGTAAAAGGAGGG + Intergenic
939918720 2:148081788-148081810 GGTACTATGTAGAATAAGAATGG - Intronic
942393988 2:175526886-175526908 TGTACTAGGTGGTACAAGGAGGG - Intergenic
945752847 2:213809895-213809917 AGTTGTATGTGGTAGAAGGATGG + Intronic
1171781418 20:29422070-29422092 TGTTTTATGTAGAAGAAGGAGGG - Intergenic
1178422620 21:32454368-32454390 GGTACTATGTAGTAGAAGGAAGG - Intronic
1181875942 22:25940877-25940899 TTTACTATTTAGTAGAAGAAGGG + Intronic
952973734 3:38675426-38675448 GCTAATAAGTAGTAGAAGGGGGG + Intergenic
953137359 3:40192882-40192904 GTTACTATGTAGAAGCATGATGG - Intronic
955204054 3:56879060-56879082 GGGACTGTGTAGTTGCAGGAAGG + Intronic
957752186 3:84435105-84435127 GGAACTTTGAAGTAGAAGGGGGG + Intergenic
957848159 3:85766494-85766516 GCCACTATGTGGTAGAAGGATGG + Intronic
959401228 3:105904584-105904606 TGTCCTATGTGGAAGAAGGAGGG - Intergenic
964551955 3:157894899-157894921 CATACCAGGTAGTAGAAGGAAGG + Intergenic
970783522 4:19768119-19768141 GGTTCCATGTAGTAGAAGTTTGG + Intergenic
972004403 4:34081060-34081082 GGGACAATGTAGAAGAAAGATGG - Intergenic
978032955 4:103958476-103958498 GGTTGTACGGAGTAGAAGGATGG + Intergenic
981575585 4:146201332-146201354 CATATTATGTAGTATAAGGAAGG + Intergenic
982233852 4:153233733-153233755 CTTCCTATGAAGTAGAAGGAAGG + Intronic
983559838 4:169089608-169089630 GCTACCATTTAGTAAAAGGAGGG - Intergenic
983893429 4:173056049-173056071 GGGACTATTTAGGAAAAGGAAGG - Intergenic
986746032 5:10746084-10746106 GGTACTATGTGGTATATGCAAGG + Intronic
986746039 5:10746123-10746145 GGTACTATGTGGTATATGCAAGG + Intronic
992105339 5:73445670-73445692 GCTACTATGTTGCAGATGGAAGG - Intronic
998513303 5:142731642-142731664 AATACTATGTCCTAGAAGGATGG - Intergenic
1005232217 6:23715434-23715456 GGTACTATGTTTTAGAAGTAAGG + Intergenic
1006145739 6:31958676-31958698 GGTACCATGTGGTTCAAGGAGGG + Intronic
1006912954 6:37575945-37575967 GGTGGGATGTAGGAGAAGGAAGG + Intergenic
1009032482 6:58076687-58076709 GGTACTATGTGGAAAATGGATGG + Intergenic
1009208092 6:60828460-60828482 GGTACTATGTGGAAAATGGATGG + Intergenic
1010494207 6:76513750-76513772 GGTAATATGGACTTGAAGGATGG + Intergenic
1010867371 6:80995614-80995636 GGAACTAAAGAGTAGAAGGATGG - Intergenic
1017408399 6:154143795-154143817 GGTATTTTGTAGTAGAAGTAAGG - Intronic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1027949528 7:84796761-84796783 AGTACTATGTTGAATAAGGATGG + Intergenic
1028665441 7:93338263-93338285 GGTACTTTGTGGTAGACTGATGG + Intronic
1030556139 7:111026176-111026198 TATACAATGTAGTAGAATGAAGG - Intronic
1033030751 7:137824005-137824027 TGTAATATGTATTGGAAGGATGG + Intronic
1034474855 7:151276268-151276290 GGTGCTAGGTAGGGGAAGGAGGG + Intronic
1037281986 8:17251468-17251490 GATTCTATGCAGTAGAAAGAAGG - Intronic
1037451551 8:19020607-19020629 GGTATTATGTATTGGAAGCAAGG + Intronic
1037622162 8:20574056-20574078 GGTACTGTGAAGAAAAAGGAAGG - Intergenic
1038941533 8:32311068-32311090 GGTACTACATAGCAGAAAGAAGG - Intronic
1042429817 8:68692707-68692729 TGTTCTCTCTAGTAGAAGGAAGG + Intronic
1043522664 8:81063253-81063275 GGTACTAAGCAGTTGAGGGAGGG + Intronic
1045146201 8:99347265-99347287 GGTACTGTGGTGGAGAAGGAGGG - Intronic
1045759366 8:105586051-105586073 GCTTCTATGTTGTAGAAGGCAGG + Intronic
1048535075 8:135285698-135285720 TGTTGTATGTAGTAGCAGGAAGG - Intergenic
1051591853 9:18784204-18784226 GGTACTATGTGGATGATGGAGGG - Intronic
1052752212 9:32503311-32503333 GGGGCCAGGTAGTAGAAGGATGG - Intronic
1061268987 9:129525757-129525779 AGTAGTATGTTGTAGCAGGAGGG - Intergenic
1061439576 9:130591514-130591536 GGTAGTATGTGGAAGAATGAAGG + Intronic
1191892012 X:65953717-65953739 AGTACTATGTAGAAGAGGGGTGG + Intergenic
1193739224 X:85198007-85198029 GGTAATATAAAGTAGAATGATGG - Intergenic
1193998546 X:88397906-88397928 AATACTATGTAGAAGAAGGGAGG - Intergenic
1195093317 X:101484252-101484274 GGTAGTATGTAGTACATGAATGG + Intronic
1198479312 X:137026705-137026727 GTTATTATTTAGTAGAAGGTAGG - Intergenic
1199290286 X:146097373-146097395 GGTACTCAGTAGAAGCAGGAGGG + Intergenic
1201461789 Y:14233346-14233368 GGCACTATGTAGAAGAAAGGAGG - Intergenic