ID: 1178424677

View in Genome Browser
Species Human (GRCh38)
Location 21:32469831-32469853
Sequence GATGAACTCCACCACGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178424677 Original CRISPR GATGAACTCCACCACGTGGA TGG (reversed) Intronic
904968609 1:34401041-34401063 GCTGAGCTTCACCACGAGGATGG + Intergenic
906544741 1:46613118-46613140 GAAGAAGTCCACCACGTGCACGG + Exonic
908404756 1:63803887-63803909 GATGCACTCAACAACTTGGATGG + Intronic
917947762 1:179993804-179993826 AATGGAATCCACCAGGTGGAGGG - Intronic
922562867 1:226581784-226581806 GATGAAATCCACTAAGAGGATGG - Intronic
1068810379 10:61249172-61249194 GATGAGCACCATCATGTGGAAGG - Intergenic
1069918780 10:71803332-71803354 GATGACCTCCACCAGGAGCATGG - Exonic
1077181301 11:1218399-1218421 GATGAACTCGGCGACCTGGAGGG - Intergenic
1080448462 11:32358842-32358864 GCTGAACTCCAGCACTTGAAGGG - Intergenic
1083297482 11:61722859-61722881 GATGAACTCGATCACCAGGATGG - Exonic
1084190170 11:67495086-67495108 GATGAACGCCACCACGTCGGCGG + Exonic
1104133145 12:125913803-125913825 GATGAACTCTACCCTGTGGCAGG - Intergenic
1108681975 13:52788225-52788247 GATCAGCTCCAGCACCTGGACGG - Intergenic
1108911294 13:55554933-55554955 GAGGAACCCCACCAGTTGGAAGG + Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1137875024 16:51988043-51988065 TATGAAGTCTACCATGTGGAGGG - Intergenic
1141134800 16:81458263-81458285 GCTGAACCCCATCACCTGGAAGG + Intronic
1141615705 16:85208274-85208296 GATGCACTCCGCCACGTCGCTGG + Intergenic
1153975954 18:10268525-10268547 GATGAAGGCCACCTCCTGGAAGG + Intergenic
1164476365 19:28578851-28578873 TATGCATTCCACCACGTGCATGG - Intergenic
925596693 2:5562461-5562483 GGTGAACTCCCCCCAGTGGATGG - Intergenic
931908193 2:66865726-66865748 CATGAAATCCACTACATGGAAGG - Intergenic
945601585 2:211872862-211872884 GATAAACTACACAAGGTGGAGGG + Intronic
945751140 2:213784424-213784446 GATAAACTACACAAGGTGGAGGG - Intronic
1169403297 20:5302232-5302254 GATGCACTCGACCACGTAGAAGG + Exonic
1176714677 21:10341124-10341146 AAAGAACACCACAACGTGGAAGG + Intergenic
1178424677 21:32469831-32469853 GATGAACTCCACCACGTGGATGG - Intronic
1179366301 21:40761146-40761168 GATAAAGTCCACTACTTGGAAGG - Intronic
950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG + Intronic
952399934 3:32953998-32954020 TCTCAACTCCACGACGTGGAAGG + Exonic
953542204 3:43831096-43831118 GATGGACTCCACCATAAGGAAGG - Intergenic
954948426 3:54447156-54447178 GATGAAAACCACCACATGCATGG + Intronic
961692061 3:128676945-128676967 CATTACCTCCACCACCTGGAAGG + Intronic
961908190 3:130284565-130284587 GATGTCATCCACCAGGTGGAGGG - Intergenic
968883915 4:3317306-3317328 GATGAACTGCAGGACGGGGAGGG - Exonic
972918067 4:43904730-43904752 ACTGAACCCCACCACATGGAAGG + Intergenic
976429370 4:84945192-84945214 CATGAAAACCACCAGGTGGAAGG + Intronic
979026149 4:115578875-115578897 AATGTACTCCTCCATGTGGAAGG + Intergenic
984356861 4:178671353-178671375 GATAAACTCCAACTCTTGGAAGG + Intergenic
987246413 5:16053610-16053632 GATAAACACAACAACGTGGATGG + Intergenic
990537244 5:56734698-56734720 GATGCACTCCAACACTTGGCAGG - Intergenic
992754391 5:79890501-79890523 CAAGAACTCCACCAGCTGGATGG + Intergenic
994724057 5:103413850-103413872 GATGAAGTCCAACACCTGTATGG - Intergenic
997035386 5:130184734-130184756 AATGTACTCCACCCCGTGCATGG - Exonic
1001594590 5:172889967-172889989 ATTAAACTCCACCACCTGGATGG - Intronic
1002565604 5:180111542-180111564 GATGAACTCCCCCACCTGCTTGG + Exonic
1003812939 6:9804836-9804858 GTTAAACTCAACCACTTGGAGGG + Intronic
1006029808 6:31170560-31170582 CATCACCTCCACCACCTGGAGGG + Exonic
1007958109 6:45935368-45935390 GCTGAACTCCACCATGTGCCAGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019870437 7:3755788-3755810 GATGCACTATACCACGTGAAGGG - Intronic
1023066123 7:36379232-36379254 AATGAACCCCACTACCTGGATGG + Intronic
1025006782 7:55361816-55361838 GAGGGGCTCCACCACGTGGAAGG + Intergenic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1030267516 7:107635465-107635487 GATGTACTCCACCAAAAGGATGG + Intergenic
1036736098 8:11317989-11318011 GATTAACTCCCCCACTTAGAAGG + Intronic
1056319828 9:85425388-85425410 GCTGAACTCCCCCACGTAAACGG + Intergenic
1187959806 X:24557839-24557861 TAGGAACAGCACCACGTGGAGGG - Intergenic
1196897770 X:120354540-120354562 GATGAACTCCACAATGTGATAGG - Intergenic
1200705504 Y:6439148-6439170 GATCCACTCCACATCGTGGAAGG + Intergenic
1201028607 Y:9725560-9725582 GATCCACTCCACATCGTGGAAGG - Intergenic