ID: 1178425294

View in Genome Browser
Species Human (GRCh38)
Location 21:32474252-32474274
Sequence GCAGAGTGGAGGGCTTTAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178425294_1178425299 13 Left 1178425294 21:32474252-32474274 CCGCTTAAAGCCCTCCACTCTGC 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1178425299 21:32474288-32474310 AATACATCAGTCTTCAGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1178425294_1178425297 -10 Left 1178425294 21:32474252-32474274 CCGCTTAAAGCCCTCCACTCTGC 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1178425297 21:32474265-32474287 TCCACTCTGCACACTGTAATTGG 0: 1
1: 0
2: 2
3: 22
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178425294 Original CRISPR GCAGAGTGGAGGGCTTTAAG CGG (reversed) Intronic
900774211 1:4569803-4569825 GCTGAGAGGAGGCCTTTGAGGGG - Intergenic
902039755 1:13484092-13484114 GCGGAGTGGAGGGGTTTAGCAGG - Intronic
905334780 1:37237049-37237071 ACAGAGGCGAAGGCTTTAAGAGG - Intergenic
905403435 1:37718539-37718561 GGAGAGTGGAGGGCCTTCATGGG - Intronic
906148150 1:43572099-43572121 GCAGGGTGGAGGTTTTCAAGTGG - Intronic
906207999 1:43997246-43997268 GCAGCCTGGATGGCTTTACGTGG - Intronic
906951058 1:50334777-50334799 GCAGAGTGAATGGCTGCAAGAGG - Intergenic
907621316 1:55983531-55983553 GCAGAGGGGAGGGGAGTAAGGGG + Intergenic
908066744 1:60414407-60414429 GCAAAGAGGAGGGCTTTGAAAGG - Intergenic
908339395 1:63161115-63161137 GCAGAGAGGCGGTCTCTAAGAGG + Intergenic
908986497 1:70030094-70030116 ACAGAGTTGAGGGCTTGAGGAGG - Intronic
911025076 1:93427317-93427339 GCAGAGAGGAGGCCTTGGAGGGG - Intergenic
912208213 1:107531602-107531624 GCAGAGTCATGGGCTTGAAGGGG - Intergenic
913971499 1:143421153-143421175 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
914065876 1:144246766-144246788 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
914113275 1:144719588-144719610 GCAGAGTGAGGGCCTTTATGGGG + Intergenic
914802064 1:150969103-150969125 GCAAAGGGGAGGGCATCAAGAGG + Exonic
916654632 1:166863474-166863496 GCAGCCTGGAGGCCTTTAATGGG - Intronic
917340699 1:173974639-173974661 TCAGAGAGGAGGGAATTAAGTGG + Intronic
918247384 1:182671881-182671903 GCAGAGAGAAGAGCTTTCAGTGG - Intronic
918508939 1:185289080-185289102 GCAGACTGGAGGATATTAAGAGG - Intronic
921596119 1:217055522-217055544 GCCAGGTGGAGGGCATTAAGGGG - Intronic
923031954 1:230256137-230256159 GCCGAGGTGAGGCCTTTAAGAGG - Intronic
923877965 1:238071631-238071653 GCAGAGTGGAGGGCTAACAAAGG - Intergenic
1065407890 10:25389243-25389265 GCTGAGTGCAGGGCTTTTATGGG - Intronic
1066286455 10:33971177-33971199 GCAGAGTGTACTGCTTGAAGGGG - Intergenic
1066311782 10:34204480-34204502 GCAAGGTGGAGGTCGTTAAGGGG - Intronic
1066981718 10:42422745-42422767 GCAGAGTGGAGGCAGTGAAGAGG - Intergenic
1071206550 10:83286266-83286288 GGAGAATGGAGGGCTTTACAAGG + Intergenic
1076549111 10:131266756-131266778 GCAGAGAGGAGGCCTTGGAGAGG + Intronic
1077695677 11:4390431-4390453 GCAGTGTGGAGACCTTTAGGGGG + Exonic
1078417633 11:11178784-11178806 CCAGAGTGGAGCTCTTTGAGGGG - Intergenic
1079237490 11:18700626-18700648 GCAGAGAGGAGGGGCTAAAGGGG + Intronic
1082700986 11:56430297-56430319 GCAGAGTGGAGGTCAGTGAGTGG + Intergenic
1084902047 11:72317058-72317080 GCAGAGTGGTGCCCTTTGAGGGG - Intronic
1089591921 11:119547099-119547121 GCAGAGAGGAGGCCCTGAAGTGG - Intergenic
1091522544 12:1261583-1261605 GTACAGTGGAGGGTTTTAAAGGG - Intronic
1091969174 12:4771642-4771664 GCAGAGTGCAGGGCATAAAAAGG + Intronic
1091969864 12:4777737-4777759 GCAGAGTAGAGAGCTTGATGAGG - Intronic
1093034780 12:14322096-14322118 TAAGAGGTGAGGGCTTTAAGGGG - Intergenic
1095566824 12:43634057-43634079 GCAGAGTGGAGGGCTGGGGGCGG - Intergenic
1096415599 12:51409887-51409909 GCTGAGTAAAGGGATTTAAGAGG + Intronic
1097974321 12:65668150-65668172 GCAGAGTGGAGGGCGTTCTGTGG + Intergenic
1099171575 12:79370857-79370879 GAAGATTGGAGGGATTTAATAGG - Intronic
1104262532 12:127197597-127197619 GGAGAGAGGAGGGCATTTAGTGG - Intergenic
1104341802 12:127956954-127956976 GCAAAGTAGATGGGTTTAAGAGG + Intergenic
1104858395 12:131912559-131912581 ACAGAGTGCAGGGCCTTCAGAGG - Intronic
1105424515 13:20283132-20283154 GCAGAGAGGAGGCCCTGAAGAGG - Intergenic
1106476244 13:30100631-30100653 GCACATTGGAGGGCTATAAATGG - Intergenic
1108181683 13:47846343-47846365 GGAGAGGGGAGGGCTAGAAGTGG - Intergenic
1111800433 13:92974529-92974551 GCAGAGAGGAGGCCCTGAAGAGG + Intergenic
1112653525 13:101424091-101424113 TCAGAGTGGAGGTCTTTGAAAGG + Intergenic
1112962628 13:105145464-105145486 GGAGAGTAAAGGGCTTTAAGGGG + Intergenic
1112962634 13:105145488-105145510 GGAGAGAAAAGGGCTTTAAGGGG + Intergenic
1114270321 14:21097166-21097188 GCAGAGTGGAGCGGGTTAGGAGG - Intronic
1119448359 14:74685852-74685874 GTAGATTGGAAGTCTTTAAGGGG - Intronic
1119995388 14:79248162-79248184 GCTGTCTGGAGGGTTTTAAGTGG - Intronic
1121010262 14:90516171-90516193 GAAGAGTCCAGGGCTTTGAGAGG + Intergenic
1121695312 14:95907773-95907795 GCAGAGAGGAGGCCCTGAAGAGG + Intergenic
1121824631 14:97000434-97000456 GCAGAGAGGAGGCCCTGAAGTGG + Intergenic
1125966046 15:43876368-43876390 GTTGGGTGGAGGGCTTTAAGAGG + Intronic
1127556794 15:60095461-60095483 GTAGAGTGGAGGGGAATAAGTGG - Intergenic
1127819707 15:62644174-62644196 GCAAATTGGAGGGCTTTAGTGGG - Intronic
1127920419 15:63490126-63490148 TCAGAGTTGGGGCCTTTAAGAGG + Intergenic
1130148543 15:81293742-81293764 GTGGAAAGGAGGGCTTTAAGGGG - Intronic
1130781143 15:87042317-87042339 CCAGAGTGGGGAGTTTTAAGAGG - Intergenic
1130912821 15:88282725-88282747 GCAGAGTGGGGGCATTAAAGTGG - Intergenic
1131643515 15:94317422-94317444 GCAGAGAGAAAAGCTTTAAGTGG - Intronic
1131963077 15:97809454-97809476 GCAGAGTGTAGGACTTTCACAGG - Intergenic
1134201796 16:12205365-12205387 GCAGAGTGACGGGATTTATGAGG - Intronic
1134310166 16:13068475-13068497 GCAGAGTTCAGTGCTGTAAGAGG - Intronic
1135327579 16:21536811-21536833 GCAGAGCGGAGGGGTCGAAGGGG + Intergenic
1136337929 16:29622831-29622853 GCAGAGCGGAGGGGTCGAAGGGG + Intergenic
1137285483 16:47012756-47012778 TGAGAGGGGAGGCCTTTAAGAGG - Intergenic
1138551026 16:57748611-57748633 GCAGAGTGGAGGGGCTTCCGGGG - Intronic
1141365642 16:83440353-83440375 GCAGAGTGGAGAGCTCCAAGTGG + Intronic
1142040692 16:87891912-87891934 GCAGAGTGGAGGGGTCGAAGGGG + Exonic
1142319766 16:89373515-89373537 GCTGAGTGGACGGCTGCAAGGGG + Intronic
1143273769 17:5694732-5694754 GCACAGTTAAGTGCTTTAAGTGG + Intergenic
1144403433 17:14929167-14929189 GCAGAGTGGACGGTTTTAAAAGG + Intergenic
1145883642 17:28368681-28368703 GCAGGGTGGTGGGCATTAGGAGG + Intronic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1146663629 17:34682119-34682141 TCTGAGTGGAGGGGTTGAAGTGG + Intergenic
1147609188 17:41791783-41791805 CCAGAGTGGAGGCCTTTTAAAGG - Intergenic
1148902398 17:50888233-50888255 GGCGAGAGGAGGGCTGTAAGTGG + Intergenic
1151149761 17:72074968-72074990 GCACAGTGTAGGGATTTTAGTGG + Intergenic
1152336129 17:79701088-79701110 GCAGAGGGGAGGGGTGCAAGTGG + Intergenic
1153924564 18:9824707-9824729 CCAGAGTGGAAGGCATTCAGAGG + Intronic
1154027002 18:10717348-10717370 GCACGGTGGAGGGCATTAGGTGG + Intronic
1154369385 18:13745211-13745233 GCCCAGTGGAGGGTGTTAAGGGG + Intronic
1155906712 18:31460679-31460701 GTTGGGTGGAGGTCTTTAAGGGG - Intronic
1156721280 18:40073007-40073029 TAAGAGTTGAAGGCTTTAAGGGG - Intergenic
1158422964 18:57312531-57312553 CCTGAGAGGAGGGCTTTAGGAGG - Intergenic
1159043416 18:63346041-63346063 ACAGTTTTGAGGGCTTTAAGGGG + Intronic
1160399557 18:78600146-78600168 TCTGAGTGGAGGGCTTTGGGTGG - Intergenic
1160699017 19:497396-497418 GGAGAGAGGAGGGAGTTAAGAGG + Intronic
1161560559 19:4970177-4970199 GCACGGTGGAAGGTTTTAAGGGG + Intronic
1161824118 19:6551147-6551169 GCAGAGAGGAGGCCTTGGAGAGG + Intergenic
1162057308 19:8072213-8072235 GCAGGGTGGAGGGGTTTCAGAGG + Intronic
1162860595 19:13503946-13503968 GCAGATTGGAGGGCTGTTGGGGG - Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1168400279 19:56081612-56081634 GTAGAGTGGAGGGTTAAAAGAGG + Intergenic
925481793 2:4283707-4283729 GCAGTGTGGAGGTCTTAGAGGGG - Intergenic
926867497 2:17375874-17375896 GGGGAGGGGAGGGCTTTTAGAGG - Intergenic
927094477 2:19737091-19737113 GCAGTGTGGAGCGCTGCAAGTGG + Intergenic
927747006 2:25632476-25632498 ACTGAGAGGTGGGCTTTAAGAGG + Intronic
928704082 2:33928738-33928760 GCAGAGTGGAGAGTTATATGGGG + Intergenic
929411070 2:41697804-41697826 GCAGCGTGCAGGTCTTTGAGAGG + Intergenic
929813214 2:45209233-45209255 GCAGAGTGGTGGGCTCTATATGG + Intergenic
930636494 2:53811761-53811783 GCAAAGTGAAGTGTTTTAAGAGG - Intronic
931514027 2:63031278-63031300 GGAGAGTGGAGAGCTGTCAGGGG + Intronic
934176193 2:89582086-89582108 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
934286503 2:91656447-91656469 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
934493791 2:94780589-94780611 GGAGAGTGGAGGGTATTAAGGGG - Intergenic
936270070 2:111042543-111042565 GCAGAGTGAAGGGCTTGAACAGG + Intronic
938945647 2:136209617-136209639 GAGGAGTGGAGGGCTATGAGAGG + Intergenic
939179114 2:138783379-138783401 GCAGAGTGGAGGGTTTTTATAGG + Intergenic
940565602 2:155356589-155356611 GCAGAGTCTAGGGCTTTCTGAGG + Intergenic
942850243 2:180475722-180475744 GAAGAGAAGAGGGCTTGAAGAGG - Intergenic
944217735 2:197272642-197272664 GGAGAGTGGAGCCCTTAAAGTGG + Intronic
946276334 2:218634471-218634493 GCAGACTGCAGGGCTTGAAATGG + Exonic
946576075 2:221077166-221077188 ACAGACTGGAGAGCTTTCAGGGG - Intergenic
947683069 2:232053765-232053787 GTAGGGTGGAGGACTTCAAGAGG - Intronic
947872914 2:233449703-233449725 GCAGGCTGGAGGGCTGCAAGCGG - Intronic
948790336 2:240373513-240373535 GCAGAGTGGTGGGCGGTAAAGGG - Intergenic
948792835 2:240388185-240388207 GCAGGGTGAAGGGCTTCAAGGGG - Intergenic
948863892 2:240765814-240765836 GCAGAGAGGAGGACTATGAGGGG + Intronic
948901475 2:240958750-240958772 GCAGTGGGGAGGGCCTTGAGAGG + Intronic
1168934652 20:1653681-1653703 ACAGATTGGAGGACTTTCAGTGG + Intronic
1169184536 20:3603224-3603246 GCAGGGAGGAGGGGTTCAAGGGG - Intronic
1170043842 20:12065459-12065481 GCAGAGAGGAGGCCTTGAAATGG + Intergenic
1171507718 20:25652577-25652599 GCAGAGTGGGGGGCTCAAATGGG + Intergenic
1172795707 20:37535752-37535774 GCAAAATGGTGGGGTTTAAGTGG + Intergenic
1172825393 20:37778756-37778778 GGCAAGTGGAGGGCTTTGAGGGG + Intronic
1173396577 20:42686041-42686063 TCACAGTGGAGGTCTTTGAGGGG - Intronic
1174673812 20:52333865-52333887 GCAGAGTGGAAGGCTTCACTGGG + Intergenic
1174845015 20:53935740-53935762 GCACAGTTGGTGGCTTTAAGAGG - Intergenic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1182270885 22:29152621-29152643 GGAGAGTGGAGGGGTGCAAGGGG - Intronic
1184037560 22:41925989-41926011 GGGGAGAGAAGGGCTTTAAGGGG - Intronic
1184445272 22:44543561-44543583 TCAGAGTGTAGCGCTTTGAGTGG + Intergenic
949474585 3:4431434-4431456 GCTGAGTGCAGGGCTTTTATGGG - Intronic
950725620 3:14915073-14915095 GCAGAGTTGAGGGCTGGAGGCGG + Intronic
951104930 3:18731769-18731791 GCTAGGTGGAGGTCTTTAAGGGG - Intergenic
953794685 3:45975512-45975534 GCAGAGAGTAAGGCTTGAAGTGG + Intronic
954099332 3:48357486-48357508 GCAGAGAGGAGGTCTTGAAGAGG + Intergenic
954156324 3:48686669-48686691 GCATAGAGGAGGGCTGAAAGAGG + Intergenic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
955063294 3:55513106-55513128 GCAGAGTTGGGTGCTGTAAGAGG - Intronic
959484317 3:106909204-106909226 GCAGAGTGGAGGCCCTGGAGAGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
964996797 3:162891900-162891922 GCAGAGAGGAGGCCCTGAAGTGG - Intergenic
966207904 3:177423572-177423594 GGAGAGAGGCGGGCTTTAAGGGG + Intergenic
967951944 3:194847996-194848018 GTGGAGTGAAGGGCTTTAAAAGG - Intergenic
968033369 3:195523246-195523268 GCAGAGTGAAGGTCTTTATTAGG - Intronic
968223834 3:196959766-196959788 GCAGTGTGGGGGGCCTGAAGTGG - Intronic
968424949 4:517055-517077 GCAGAGGAGATGGCATTAAGGGG + Intronic
969511092 4:7618378-7618400 GCAGAGTGGAGGGCAGACAGAGG - Intronic
970697764 4:18697694-18697716 TCAGAGTGGAGGGCTTGAAAAGG + Intergenic
971079773 4:23195935-23195957 GCAGAGAGGAGGCCCTCAAGAGG - Intergenic
971938766 4:33188447-33188469 GCAGAGAGGAGGCCTTGAAGTGG + Intergenic
974644182 4:64671483-64671505 GCTGAGTGCAGGGCTTTTATGGG + Intergenic
975069115 4:70111146-70111168 ACAGAGTTGAGGGCATTGAGAGG - Intergenic
975221164 4:71814355-71814377 GCAGAGAGGAGGGCCTAGAGTGG + Intergenic
976754736 4:88485743-88485765 GCAGAGTGAATGTCTATAAGTGG + Intronic
977639104 4:99335029-99335051 GTAGAGTTGAGGGCATTAGGTGG - Intergenic
979649467 4:123114032-123114054 GCAGAGAGGAGGCCCTGAAGAGG + Intronic
985876404 5:2601902-2601924 GCAGAGAGGAGGGAGTTCAGAGG - Intergenic
986905852 5:12492457-12492479 CCAGAGTGGGGAGTTTTAAGAGG - Intergenic
990695330 5:58409891-58409913 ACAGTGTGAAGGGCTTTATGTGG - Intergenic
992257918 5:74940571-74940593 GAAGAGTGGAGGGCTGGGAGCGG + Intergenic
997559167 5:134830384-134830406 GTATAGAGGAGGGGTTTAAGGGG + Intronic
999018393 5:148135108-148135130 CCAGAGTAGAGGTCTTTAAATGG - Intronic
1000426242 5:161094003-161094025 GCAGAGAGGAGGCCTTGCAGTGG - Intergenic
1001095682 5:168773775-168773797 GCAGGGTGGAGGGGGTTAAGCGG + Intronic
1006203351 6:32316986-32317008 GGAGAGGAGAGGGTTTTAAGAGG + Intronic
1006238715 6:32658781-32658803 TCACAGTGGAGGGGTGTAAGGGG - Intergenic
1006808102 6:36801795-36801817 GCAGGGTGGAGGGGTATAGGGGG + Intronic
1007246346 6:40465980-40466002 GTAGACTGTAGGGCCTTAAGAGG - Intronic
1011113757 6:83867106-83867128 GCAGAGTGAAGCACCTTAAGAGG + Intronic
1011910471 6:92430537-92430559 TCAGAGTGGAGGATTTTAACAGG + Intergenic
1012310190 6:97714494-97714516 GCAGATTAGAGGTTTTTAAGAGG + Intergenic
1013086347 6:106861187-106861209 GCAGAGGGGAGGCCCTGAAGAGG + Intergenic
1015663746 6:135603917-135603939 GCAGAGAGGAGGCCCTAAAGTGG - Intergenic
1017077632 6:150633472-150633494 GCAGAGTGCAGAGCTTTAGCTGG + Intronic
1017604967 6:156123966-156123988 GCAGGGTGGGGGACTTCAAGGGG + Intergenic
1017617640 6:156261836-156261858 GCAGAGTGGATGGAGTAAAGAGG + Intergenic
1018726893 6:166619671-166619693 GCAGAGAAGATGGCTTTGAGAGG - Intronic
1021894446 7:25220962-25220984 GCAGAGTGTGGGGCTTCAGGGGG - Intergenic
1026340372 7:69429447-69429469 GCAGTTAGGAGAGCTTTAAGGGG - Intergenic
1029899353 7:104022718-104022740 GCAGAGAGGAGGCCCTTGAGTGG - Intergenic
1033653708 7:143360256-143360278 GGAGAGTGCAGGGATATAAGAGG - Intronic
1037553938 8:20004212-20004234 GCAGAGAGGAGGCCCTGAAGTGG + Intergenic
1041566940 8:59289222-59289244 TCAGAGTGGAGGGCATTCAAAGG + Intergenic
1042696564 8:71559703-71559725 ACAGAGTGTATGGCATTAAGGGG - Intronic
1044426909 8:92062643-92062665 GCAGAGAGGAGGGCCATCAGAGG + Intronic
1044820225 8:96151025-96151047 GGAGTGTGAAGGGCTTTAAGGGG + Intronic
1045197008 8:99942917-99942939 TCAGAGTGGAAATCTTTAAGTGG + Intergenic
1046200669 8:110923839-110923861 GCAGAGGGGGGGGGTTTAAATGG + Intergenic
1047954439 8:129962669-129962691 GCAGAGGGGAGGGATAGAAGAGG - Intronic
1048603068 8:135939742-135939764 GAAGACTAGAGGGATTTAAGTGG + Intergenic
1049996499 9:1040111-1040133 GCAAAGTGTAAGGCTCTAAGTGG + Intergenic
1052107177 9:24533405-24533427 GCAGATTGGGGTGATTTAAGGGG + Intergenic
1059406347 9:114100069-114100091 GCAGCGTGTAGGGCCTTTAGGGG + Intergenic
1059660323 9:116393755-116393777 TCAGAGTGGAGGGCCATTAGTGG + Intronic
1060528151 9:124332093-124332115 GGAGAGGGAAGGGCCTTAAGGGG + Intronic
1061040222 9:128137378-128137400 GTAGAGGGAAGGGCTGTAAGAGG - Intergenic
1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG + Intergenic
1188686285 X:33074535-33074557 TGAGAGGGGAGGCCTTTAAGAGG + Intronic
1188859845 X:35243937-35243959 GCAGAGAGGAGGCCTTGGAGTGG + Intergenic
1188956830 X:36443365-36443387 CCAGAGTGGAGTGCTTTTTGGGG - Intergenic
1189445675 X:41078577-41078599 GCAGGGTGGAGGGCTAACAGAGG + Intergenic
1189899137 X:45687645-45687667 GGAGAGTGGAGGGCTGGAAAAGG - Intergenic
1190371697 X:49748782-49748804 GCAGAGTGGAAGGCCTTACTAGG - Intergenic
1190552641 X:51600305-51600327 GAAGAGTGGAGGGGTTGAAGAGG + Intergenic
1190778732 X:53576978-53577000 GCAGAGGTGAGGGCTTCAAAGGG + Exonic
1193485685 X:82083437-82083459 TCAGGGTGGAGTGCTTCAAGAGG + Intergenic
1197119516 X:122873761-122873783 GCAGAGGGAAGGCCTTTAAGAGG - Intergenic
1197421299 X:126238633-126238655 GCAGAGAGGAGGCCTTGGAGAGG - Intergenic
1199089738 X:143677743-143677765 GCAGAGGAGATGGCTTTGAGAGG - Intergenic
1201275763 Y:12296886-12296908 ACAGAGTGGGGGCCTGTAAGAGG - Intergenic
1202249317 Y:22853422-22853444 GGTGAGTTGAGGGCTTTGAGGGG + Intergenic
1202402303 Y:24487170-24487192 GGTGAGTTGAGGGCTTTGAGGGG + Intergenic
1202468477 Y:25182914-25182936 GGTGAGTTGAGGGCTTTGAGGGG - Intergenic