ID: 1178435942

View in Genome Browser
Species Human (GRCh38)
Location 21:32558576-32558598
Sequence AGGGTCCCTTTTAAGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178435942_1178435953 17 Left 1178435942 21:32558576-32558598 CCTTAAATCTTAAAAGGGACCCT No data
Right 1178435953 21:32558616-32558638 CCTTTAACCCAAGGTAGGTCAGG No data
1178435942_1178435944 -6 Left 1178435942 21:32558576-32558598 CCTTAAATCTTAAAAGGGACCCT No data
Right 1178435944 21:32558593-32558615 GACCCTAACCCTCCTAAGTTGGG No data
1178435942_1178435950 8 Left 1178435942 21:32558576-32558598 CCTTAAATCTTAAAAGGGACCCT No data
Right 1178435950 21:32558607-32558629 TAAGTTGGGCCTTTAACCCAAGG No data
1178435942_1178435951 12 Left 1178435942 21:32558576-32558598 CCTTAAATCTTAAAAGGGACCCT No data
Right 1178435951 21:32558611-32558633 TTGGGCCTTTAACCCAAGGTAGG No data
1178435942_1178435943 -7 Left 1178435942 21:32558576-32558598 CCTTAAATCTTAAAAGGGACCCT No data
Right 1178435943 21:32558592-32558614 GGACCCTAACCCTCCTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178435942 Original CRISPR AGGGTCCCTTTTAAGATTTA AGG (reversed) Intergenic
No off target data available for this crispr