ID: 1178440413

View in Genome Browser
Species Human (GRCh38)
Location 21:32593827-32593849
Sequence GCTCTGTGCACAGGGCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178440413_1178440427 24 Left 1178440413 21:32593827-32593849 CCCAAAGGCCCTGTGCACAGAGC 0: 1
1: 0
2: 1
3: 15
4: 246
Right 1178440427 21:32593874-32593896 CCCACCGCCCCCCGCCGCCGGGG 0: 1
1: 0
2: 16
3: 95
4: 613
1178440413_1178440425 23 Left 1178440413 21:32593827-32593849 CCCAAAGGCCCTGTGCACAGAGC 0: 1
1: 0
2: 1
3: 15
4: 246
Right 1178440425 21:32593873-32593895 CCCCACCGCCCCCCGCCGCCGGG 0: 1
1: 0
2: 9
3: 138
4: 968
1178440413_1178440423 22 Left 1178440413 21:32593827-32593849 CCCAAAGGCCCTGTGCACAGAGC 0: 1
1: 0
2: 1
3: 15
4: 246
Right 1178440423 21:32593872-32593894 CCCCCACCGCCCCCCGCCGCCGG 0: 1
1: 1
2: 20
3: 141
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178440413 Original CRISPR GCTCTGTGCACAGGGCCTTT GGG (reversed) Intronic
901059394 1:6465193-6465215 GCTCCGTGCAAGGGGCCTTCAGG + Exonic
902612545 1:17605670-17605692 GCTGTCTGCACAGGGCCGCTGGG + Intronic
907387400 1:54135009-54135031 CCTCTGGGGACATGGCCTTTTGG - Intronic
908006445 1:59733753-59733775 GCTCTGTGCACACAGCCGTAAGG + Intronic
911732337 1:101304220-101304242 GCTCTGGGCACATTGCCTTTGGG + Intergenic
915412150 1:155709847-155709869 ACTCTGTGCATACTGCCTTTAGG + Intronic
915973692 1:160371239-160371261 TGCCTGTGCCCAGGGCCTTTGGG - Exonic
918663661 1:187120579-187120601 GTTCTATCCACAGAGCCTTTGGG + Intergenic
920040356 1:203091338-203091360 CCTATGGGAACAGGGCCTTTGGG + Intronic
920349959 1:205331389-205331411 GATCTGTAGACAGGGCCTCTGGG + Intergenic
920384935 1:205564392-205564414 CCTCTGTCCCCAGGGCCTTCTGG - Intergenic
920826988 1:209431611-209431633 GCTCTTTGGACAGTGCCTTGTGG + Intergenic
921556476 1:216604287-216604309 GCTCAGTGAAGAGGGCCTGTTGG + Intronic
922484844 1:225965719-225965741 ACTCTGGGCACAGTGCCTATGGG + Intergenic
922538495 1:226401350-226401372 GCTCTCAGCACAGTGCCTGTGGG - Intronic
923507148 1:234614067-234614089 GCTCTGTGCACAGGGGAGGTAGG - Intergenic
924424562 1:243939473-243939495 GGTCTGGGAACAGCGCCTTTGGG - Intergenic
1063386441 10:5619201-5619223 GCTCTGTGCACGGGGCTCCTGGG - Intergenic
1069683559 10:70301655-70301677 GCCCTGTGCAAAGGGCCATCGGG + Intronic
1070769270 10:79072881-79072903 GCTCTCTGCTCATGCCCTTTGGG + Intronic
1072606583 10:96988750-96988772 GTTCTGTGCAGACTGCCTTTCGG + Intergenic
1074401463 10:113144287-113144309 CCTCTGTCCACAGAGCCTCTGGG - Intronic
1075077490 10:119360801-119360823 GCTCTGTTCCCAGGCCCTGTGGG + Intronic
1075291201 10:121232662-121232684 GCTCTGTGAAGAGGGCCATGTGG - Intergenic
1075944359 10:126419453-126419475 GCTCTGTGTCCAGGGTCCTTGGG - Intergenic
1076131625 10:128017739-128017761 TCTCTGTGCACCGAGGCTTTTGG + Intronic
1076775981 10:132698534-132698556 GCTCTGTGCACGTGATCTTTGGG + Intronic
1076803143 10:132841817-132841839 GCTCTCTGCCCAGGGCCTGCTGG - Intronic
1077211286 11:1371986-1372008 GCTCTGTGCACAGGGGCCAAGGG + Intergenic
1077218181 11:1403801-1403823 ACTCTCTGCACAGGCCCTGTGGG - Intronic
1077558840 11:3243064-3243086 GCTCTGGGCACACAGCCTATGGG + Intergenic
1078063478 11:8062715-8062737 GCTCTGCCCACAGGGACTCTAGG + Intronic
1078858466 11:15225838-15225860 GCCCTGTGCTCAGTGCCTTCTGG - Intronic
1079336659 11:19576097-19576119 GCTGTGTGCAAAGGGCACTTAGG - Intronic
1080451271 11:32380907-32380929 GCTCAGTTCACAGGGCGATTTGG - Intergenic
1080642024 11:34163808-34163830 ACTCTGAGCACAGGACCCTTGGG - Intronic
1081804756 11:45884515-45884537 GCCCTGTGGACAGGGTCTCTAGG + Intergenic
1081849000 11:46261881-46261903 GCTAGGTGGTCAGGGCCTTTAGG - Intergenic
1082980502 11:59116449-59116471 GCTCTGTGGAAAGGGCCTTTGGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084275432 11:68048949-68048971 GCGTCGTGCACATGGCCTTTGGG + Exonic
1084447563 11:69212632-69212654 GCTCTGAGCACATGGCCCATTGG + Intergenic
1085265566 11:75236096-75236118 GCTCTGTGGCCTGGGCCTCTGGG - Intergenic
1085726392 11:78958668-78958690 GCTGTGGGCAGAGGGCCTCTGGG + Intronic
1087913091 11:103775952-103775974 TCTCTGTGCTCAAGGCCATTTGG + Intergenic
1089005268 11:115085612-115085634 GCTCTCTGCCCAGTTCCTTTTGG + Intergenic
1089005947 11:115090924-115090946 AATCTGTGCACAGCTCCTTTAGG - Intergenic
1090806857 11:130208348-130208370 GGTCTGTGCACACGGCCTCGCGG - Intronic
1091341048 11:134814204-134814226 TCTATGTGCACAGGGACTTGGGG + Intergenic
1091995083 12:4987117-4987139 GCTCAGAGCACAGGGCCTACAGG + Intergenic
1093329073 12:17813119-17813141 GCTCTGTGAACACAGGCTTTAGG + Intergenic
1093547044 12:20360623-20360645 GGTCTCTGCTCAGGGCCTTCTGG - Intergenic
1096817607 12:54211217-54211239 GCTATGAGCAGAGGGCCTTAGGG + Intergenic
1096976175 12:55700355-55700377 GCTCTGTGCACAGGGCTCAGCGG - Exonic
1100799066 12:98212448-98212470 ACGCTGTGCACAGGGCTCTTGGG - Intergenic
1101796048 12:107975269-107975291 GCTCTGGGCACACTGCCTATGGG - Intergenic
1102211224 12:111128620-111128642 GCTCAGAGCACAGGGTCATTTGG + Intronic
1103298612 12:119909505-119909527 GCTCTGTGGACAGGGCCATGGGG - Intergenic
1103460682 12:121102340-121102362 GCTCTGGGCACACTGCCTATGGG - Intergenic
1103983978 12:124755081-124755103 GTTCTCTCCCCAGGGCCTTTTGG - Intergenic
1104146643 12:126040434-126040456 GCTTTGAGCACAGAGCTTTTTGG + Intergenic
1104621131 12:130313617-130313639 GCTCTGGGCACACTGCCTGTGGG + Intergenic
1108146373 13:47481569-47481591 GCTCTGGGCAAAGGACCTTGGGG + Intergenic
1109023396 13:57129252-57129274 TCTCTGTGCACATGTCCTCTTGG + Intergenic
1113424565 13:110197423-110197445 GCTCTGACCAAGGGGCCTTTGGG - Intronic
1118328661 14:64799344-64799366 GCTCTCTGCATGGGGCCTTATGG - Intronic
1118843293 14:69528212-69528234 GCACTGTTCACAGGGCTGTTGGG + Intronic
1118984600 14:70742631-70742653 GCTCAGTGCAGAGGGGCTCTGGG + Intronic
1119620189 14:76126057-76126079 GCTTTGTGCAGAGGGCTTTGGGG - Intergenic
1120106563 14:80502085-80502107 GCTCTGGGCACACTGCCTATGGG + Intronic
1121329151 14:93039174-93039196 GTTCTGGGCACAGGCCTTTTGGG + Intronic
1121561992 14:94882762-94882784 GCTGAGTGGACAGGGCCTTTTGG - Intergenic
1202868701 14_GL000225v1_random:139457-139479 GCTCTGCCTACAGGGGCTTTGGG + Intergenic
1125574703 15:40747301-40747323 GCTTTGTGAGCTGGGCCTTTAGG - Intronic
1129826375 15:78637617-78637639 GGTCTGTGCTCTGGGCCTTCTGG - Intronic
1132291083 15:100704375-100704397 GCTCTGTGAACCGGGCCTGGTGG + Intergenic
1135034838 16:19068209-19068231 GATCTGTGAACAGGACCTTTAGG + Intronic
1135356184 16:21771009-21771031 GCTCTGTGGACAGGCCTTTCTGG + Intergenic
1135406488 16:22201811-22201833 CCACTGTGCACAGGGAATTTGGG + Intergenic
1135436277 16:22428784-22428806 GCTGTGTCCACTGGGCCTTGAGG - Intronic
1135454675 16:22587148-22587170 GCTCTGTGGACAGGCCTTTCTGG + Intergenic
1136519302 16:30786052-30786074 GCTGTGTGCACAGGGGCAGTGGG + Intronic
1137518681 16:49173122-49173144 GGTCTGTGCCCAGGGTCTTGAGG - Intergenic
1139891047 16:70253494-70253516 GGGCTGTGCCCAGGGCCTGTGGG + Intronic
1139958264 16:70703606-70703628 GCTGCGTCCACAGGGCCTCTGGG - Intronic
1141586116 16:85034704-85034726 GCTGTGTGCCCAGTGCCTTATGG + Intronic
1142204530 16:88776585-88776607 GCTGTGTGCTCAGGGCATCTGGG + Intronic
1143033525 17:3981573-3981595 GCACTGAGCCCAGGGCCTGTTGG + Intergenic
1144178492 17:12731013-12731035 GCTCTGGGCACTGGCCCCTTGGG - Intronic
1145216283 17:21054908-21054930 GCACTGTGCCCAGGGCATTTTGG - Intergenic
1145939493 17:28735167-28735189 GCTCTGTGCATAAGCCCATTTGG - Intronic
1147152230 17:38524143-38524165 ACTCTGAGCACAAGGCCTGTGGG + Intergenic
1147664100 17:42134841-42134863 GCCCTGTGCACAGGCACTTCTGG + Intronic
1148475756 17:47927678-47927700 GGTCTGTGCACAGGGTCTGTGGG + Intronic
1149668381 17:58382769-58382791 GCTCAATGCACAGGGTCTTAAGG + Intronic
1150227196 17:63530603-63530625 GCTCTGGGCCCAGGCCCTTCTGG + Intronic
1150346311 17:64407150-64407172 GCTCTGGGCACACTGCCTATAGG + Intronic
1152035934 17:77872856-77872878 GCTCTGAGCACACGGGCTCTTGG - Intergenic
1152292271 17:79446738-79446760 GCTCTCAGCACACGGCCTATGGG + Intronic
1153227701 18:2910617-2910639 GCACTGTGAACAGGGCCTCCTGG + Intronic
1154315218 18:13298713-13298735 GCTCTGGGCACAGCTCCTTGGGG + Intronic
1156991850 18:43418712-43418734 ACTCTGGGCACAGCGCCTATGGG + Intergenic
1158393405 18:57061853-57061875 GAACTGTGCAAAGGGCCTGTGGG - Intergenic
1161314392 19:3611130-3611152 CCTCTGAGCACAGGGCCTGGAGG - Exonic
1162990766 19:14300678-14300700 ACTCTGGGCACACTGCCTTTTGG + Intergenic
1164578390 19:29419265-29419287 GCTCAGGTCACAGGGCTTTTGGG - Intergenic
1164779848 19:30883515-30883537 GCTCTGGGCACACTGCCTGTGGG + Intergenic
1167348344 19:48960803-48960825 CCTTGGTGCACAGGGCCTGTGGG - Exonic
925004991 2:435893-435915 GCTTTGTGCACAGAGACTTAAGG - Intergenic
926144643 2:10389298-10389320 GCTCTGGGCACACTGCCTGTGGG + Intronic
926414368 2:12634470-12634492 GCTCTGTGTACAAGGTTTTTTGG + Intergenic
926688589 2:15717381-15717403 GCTCTCTGCAAAGGGCCCCTGGG + Intronic
927031024 2:19120585-19120607 GCTCTGTGCCCAGATCTTTTGGG - Intergenic
928059179 2:28092896-28092918 GCTATGTGCCCAGGGACTGTCGG - Intronic
931999181 2:67868199-67868221 GCTCTTTGGACCGGGCTTTTTGG - Intergenic
932811614 2:74831085-74831107 ACTCTGGGCACACGGCCTTATGG + Intergenic
933639829 2:84747516-84747538 GCCCTGTCCCCATGGCCTTTTGG + Intronic
934719936 2:96566883-96566905 ACTCTGTGCACACTGCCTATGGG + Intergenic
936459354 2:112701275-112701297 GCTCTGGGCACATTGCCTATGGG - Intergenic
937153911 2:119704895-119704917 GTTCTGTGCCCAGGTCCTGTGGG + Intergenic
937228804 2:120384904-120384926 CCTCTGTGCACAGGCCCTAGGGG - Intergenic
937347608 2:121136242-121136264 GCTCTGGGCACACTGCCTCTGGG - Intergenic
937456032 2:122042531-122042553 GCTCTGGGCACACTGCCTCTGGG + Intergenic
937994657 2:127684016-127684038 GCCCTGTGCACATGCCCATTTGG - Intergenic
938074405 2:128324004-128324026 TCTCTGGGCCCAGGGCCTATGGG + Intergenic
938077724 2:128348835-128348857 GCTCTGTGCCCAGGTCCTGAGGG + Intergenic
938310499 2:130285807-130285829 GCCCTGGGCACAGGGTCTGTGGG - Intergenic
938444428 2:131366560-131366582 GCCCTGGGCACAGGGTCTGTGGG + Intergenic
945876313 2:215281705-215281727 GCTCTGTGGAGAGGGCCATGTGG + Intergenic
946702373 2:222425568-222425590 TCGCAGTGCACAGGGACTTTAGG + Intronic
947395142 2:229679081-229679103 ACTCTGTCTACAGGGCCTCTGGG - Intronic
947612469 2:231532534-231532556 GCACTGTGCAGAGGGCCCTAGGG + Intergenic
947881959 2:233523877-233523899 GGTCTGTGCATAGTGCCTGTGGG - Intronic
1169980397 20:11378274-11378296 GCTCTGGGCACAGTGTCTGTGGG - Intergenic
1170052708 20:12164253-12164275 GCACTGTCCAAAGTGCCTTTGGG - Intergenic
1170413119 20:16111694-16111716 GCTTTGTGCACAGGGACATGAGG + Intergenic
1170451851 20:16491211-16491233 GGTGTGTGCACCGGGGCTTTGGG - Intronic
1170461564 20:16581579-16581601 ACTCTGGGCACAGTGCCTCTGGG - Intergenic
1171148227 20:22804219-22804241 GCTCTGTGCTCAGGCCCCATGGG - Intergenic
1171404326 20:24899877-24899899 GCTCTGTTCAGAGGGGTTTTGGG - Intergenic
1173700496 20:45066457-45066479 GCTCTGTGGACAAAGTCTTTGGG + Intronic
1174157925 20:48528637-48528659 GCTCTGGTCACATGGCCTCTTGG - Intergenic
1175228690 20:57460230-57460252 ACTCTGAGCTCAGGGCCTGTGGG + Intergenic
1178440413 21:32593827-32593849 GCTCTGTGCACAGGGCCTTTGGG - Intronic
1178954535 21:37010537-37010559 GCTCAGAGTACAGGGCCTTGAGG - Intronic
1179018873 21:37619442-37619464 GCTCTTTTCAAAGGACCTTTTGG + Exonic
1179944659 21:44664902-44664924 TCTCTGTGCACAGGGCAGGTAGG + Intronic
1180074085 21:45453906-45453928 CCTCTGAGCACAGAGCCTTCGGG + Intronic
1180144679 21:45912642-45912664 TCTCTGGGCACAGGGCCTGCTGG - Intronic
1180180590 21:46117164-46117186 GCTCTGCCCTCAGGGCCTCTGGG + Intronic
1180865403 22:19115868-19115890 GGTTTGTGCACAGGGCTTATTGG - Intronic
1182431038 22:30299048-30299070 GCCCTGTGCCCTGGGCCTATGGG - Intronic
1182860943 22:33558827-33558849 GTTCTGTCCACAGAGCCATTGGG - Intronic
1183548768 22:38469113-38469135 GCTCCTTCCACAGGGCCTTCGGG - Intronic
1184612732 22:45615364-45615386 GCTCTGGGCACACTGCCTATGGG - Intergenic
1184765620 22:46570544-46570566 GCTCTGGGCACAGGGCAGGTGGG - Intergenic
1185006978 22:48285070-48285092 GCTCTGGGCACACTGCCTATGGG + Intergenic
1185127432 22:49018937-49018959 GCTCAGGGCAGTGGGCCTTTGGG - Intergenic
1185340157 22:50287528-50287550 GCTCTGGGCACCGAGCCTTAGGG - Intronic
950020502 3:9784149-9784171 GCTAATTGCCCAGGGCCTTTTGG - Exonic
950508949 3:13414244-13414266 GCTCTGTAGACACTGCCTTTGGG - Intronic
953140172 3:40222157-40222179 GCTCTGGGCACACTGCCTATGGG - Intronic
953669684 3:44952094-44952116 TAGCTGTGCACAGTGCCTTTGGG - Intronic
953751412 3:45611371-45611393 GCTGTGTGCACAGGGCTTGATGG + Intronic
954975155 3:54686745-54686767 GCTCTGTGAAGATGGCTTTTTGG + Intronic
956381736 3:68671261-68671283 GCTTTGTGCACAGTGCATTCTGG - Intergenic
956900413 3:73709554-73709576 GCTCTGGGCAGAGGGCTTCTGGG - Intergenic
957515223 3:81241376-81241398 GCTCTCAGCACAGGGGCTTTTGG + Intergenic
960439284 3:117666888-117666910 GCTCTGTGTACAGGACTTTCAGG + Intergenic
961744948 3:129058744-129058766 GCTCTGGGCACACTGCCTGTGGG + Intergenic
963628668 3:147706626-147706648 GTTCTGTGGACAGGATCTTTTGG - Intergenic
964641837 3:158916709-158916731 GCTCTGGGCACACTGCCTGTTGG + Intergenic
967036478 3:185652047-185652069 GCTCTGTGCCCAGAGCCTGCAGG + Intronic
967104205 3:186242281-186242303 GCCCTCTGCACAGATCCTTTGGG + Intronic
967865267 3:194185024-194185046 CCTCAGAGCACAGGGCCTTTTGG - Intergenic
967988200 3:195111764-195111786 GCTGTCTTCACAGGGCCTTGAGG + Intronic
968485267 4:857819-857841 GCTCTCTGCACAAGACATTTGGG - Intronic
968634396 4:1670475-1670497 GGTCTGTGCACAGGTCCTGACGG + Intronic
968783195 4:2598902-2598924 GCTCTGTGCTCACGGCCTTGGGG + Intronic
968882394 4:3308101-3308123 GCACTGTGCACACGGCCCCTGGG - Intronic
968900180 4:3427231-3427253 CCTCTGTGCCCAGGGCCTGCTGG + Intronic
969222448 4:5770070-5770092 GCTCTCTGCACAGAGCTTCTGGG + Intronic
969521024 4:7677870-7677892 GCTCAGAGGGCAGGGCCTTTGGG - Intronic
969583983 4:8081407-8081429 TCTTTGTGCACAGGGCCTCCAGG + Intronic
969698968 4:8755272-8755294 GCTCTGGGCACACTGCCTGTGGG + Intergenic
969870426 4:10101180-10101202 CCTCAGTGCACAGGTCATTTCGG - Intronic
970561813 4:17288969-17288991 ACTCTGTGAGCAGGGCCTTATGG - Intergenic
971188347 4:24402683-24402705 GCTCTGTCCACTAGGCCTCTGGG - Intergenic
971191670 4:24434550-24434572 GCTCGGTGCACAGGGTCTCAGGG + Intergenic
971242873 4:24904380-24904402 GCTCTGGGCACACTGCCTATGGG + Intronic
973672282 4:53233099-53233121 TGTCTGTTCACAGGGCATTTAGG - Intronic
976479671 4:85525958-85525980 GCTCTGAGAACAGGCCCTTGGGG - Intronic
980715320 4:136619716-136619738 ACTCTGTGCACACTGCCTGTGGG + Intergenic
981324670 4:143432130-143432152 GCCCACTGCGCAGGGCCTTTTGG + Intronic
981559215 4:146028805-146028827 GCTCTGAGCACTGGAGCTTTGGG - Intergenic
983034425 4:162845199-162845221 GCTCTGGGCACACTGCCTGTGGG - Intergenic
984226680 4:177043805-177043827 GCTCTGGTCTCTGGGCCTTTGGG - Intergenic
984432309 4:179664787-179664809 GCTCTGGGCACACTGCCTATGGG + Intergenic
985682977 5:1266109-1266131 GAGCTGTGCACAGGGCCTGCAGG - Intronic
986111091 5:4718584-4718606 GCTCTCAGCACACGGCCTGTGGG - Intergenic
986483587 5:8213450-8213472 GCTCTGTGCACGGGTCCTGAGGG + Intergenic
987178819 5:15345136-15345158 GGTCTGTCCAAAGGGCATTTTGG - Intergenic
994164873 5:96598041-96598063 TCTCTGAGCACAGGACCTTCGGG - Intronic
995681871 5:114729424-114729446 GGTCTCTTCACAGGGACTTTTGG + Intergenic
997517918 5:134503949-134503971 GTTCTGGCCACAGGGGCTTTAGG + Intergenic
999823378 5:155250729-155250751 GCTCTGTGCTCAGGGATTTGAGG + Intergenic
1001512917 5:172336386-172336408 GCTCTGGGCACAGGGCCAAGTGG + Exonic
1002212175 5:177605568-177605590 CCTCTGTGCACAGGGACTCAAGG + Intronic
1002393789 5:178937606-178937628 GCTCTGTGAAATGGGCCTCTGGG + Intergenic
1002542008 5:179912616-179912638 GCTCTGTGGACTGGGCCAGTAGG - Intronic
1003311768 6:4975152-4975174 GCTTTGTGCACAGGGCTTTGTGG - Intergenic
1006746482 6:36346403-36346425 GCTCTGGGCACACTGCCTGTGGG + Intergenic
1007299967 6:40860371-40860393 GCTCCATGGACAGTGCCTTTTGG - Intergenic
1013371334 6:109473366-109473388 GCCCTGGGCACAGGGCCCTCAGG - Intronic
1014574829 6:123057268-123057290 GCTATGGGCAAAGGGCCTTAAGG - Intronic
1016979710 6:149843193-149843215 GCTCTGAGGACATGGACTTTCGG - Intronic
1017032085 6:150233162-150233184 GCTCTGTTCCCAGGCCCCTTGGG - Intronic
1017071033 6:150575820-150575842 GTTCTGGGCACAGGGCCACTGGG - Intergenic
1018073826 6:160191629-160191651 CTTGTGGGCACAGGGCCTTTGGG - Intronic
1018183339 6:161243473-161243495 GCTCTGGGCACACAGCCTTGTGG - Intronic
1018824539 6:167399173-167399195 GCTTTGCACCCAGGGCCTTTGGG - Intergenic
1019300047 7:298277-298299 GCTCTGCTCACAGGGCTGTTGGG - Intergenic
1019493586 7:1326038-1326060 GCTCTTTGGACGGGGCCTCTGGG + Intergenic
1023185128 7:37525032-37525054 TGTTTGTTCACAGGGCCTTTTGG + Intergenic
1024633158 7:51265537-51265559 CCTCTGTGCACATGTGCTTTGGG - Intronic
1024673484 7:51617530-51617552 GCTCTGACCACAGGGCCTGTGGG - Intergenic
1029113464 7:98224771-98224793 TCTCCCTGCACAGGGCCTTCGGG - Intronic
1031825360 7:126558795-126558817 GCTCTTTGTACAGGCCATTTAGG - Intronic
1036293660 8:7517804-7517826 GCTCTGTCCCCAGGGCGTATCGG - Intergenic
1036328901 8:7803191-7803213 GCTCTGTCCCCAGGGCGTATCGG + Intergenic
1037061161 8:14511360-14511382 TCTCTGTGCAGTGGGCCTATTGG - Intronic
1037563720 8:20098295-20098317 GGACTGTGCACTGGGTCTTTGGG - Intergenic
1038668190 8:29559896-29559918 GCTATGAGAACAGGTCCTTTTGG - Intergenic
1039079630 8:33722338-33722360 GCTCTGTCCACGGGGCCCTGGGG - Intergenic
1039956012 8:42207658-42207680 GCTCAGTGGACAGGGCCATGAGG + Exonic
1040007945 8:42636584-42636606 GCTGTGAGCTCATGGCCTTTGGG + Intergenic
1040953975 8:52961416-52961438 GGGCTGTGCACAGCGCTTTTTGG + Intergenic
1041984302 8:63902718-63902740 GCTCTTTTCACTGGGCTTTTTGG + Intergenic
1046646648 8:116793125-116793147 ACTCTGGGCACACGGCCTATGGG - Intronic
1048554683 8:135463209-135463231 CGTCTGAGCACAGGGCCCTTGGG + Intronic
1049488297 8:142877661-142877683 GCCCTGGGCACAGTGCCTCTGGG + Intronic
1049493187 8:142915685-142915707 GCCCTGGGCACAGTGCCTCTGGG + Intronic
1049584578 8:143426947-143426969 GCTCTGTGCAAAGGGCTCCTGGG + Intronic
1049665845 8:143842066-143842088 GCTCCATGCACTGGCCCTTTGGG + Intergenic
1055729714 9:79267855-79267877 CTTCTGAGCACAGGGCCCTTTGG + Intergenic
1058623336 9:106906272-106906294 GCTCTTTTCAGAGGGCCTGTGGG + Intronic
1059107125 9:111521520-111521542 GCTCTGAGCCCAAGGCTTTTAGG - Intergenic
1061587346 9:131577569-131577591 GCTCTGCACACAGGGCCCTTGGG - Exonic
1061636835 9:131916762-131916784 TTGCTGTGCACAGTGCCTTTAGG - Intronic
1061645970 9:132002137-132002159 GCTCTGAGCTCAGGGCCTGCTGG - Intronic
1061678589 9:132231672-132231694 GCAGTGGCCACAGGGCCTTTGGG - Intronic
1061855663 9:133440726-133440748 GCTCTGGGCACAGGCACATTTGG - Intronic
1062131237 9:134894552-134894574 GCTCTGGGCACACTGCCTATGGG + Intergenic
1062331104 9:136045307-136045329 GCTCTGGCCACAGGGCCTGTGGG - Intronic
1062331122 9:136045363-136045385 GCTCTGGCCACAGGGCCCGTGGG - Intronic
1062389500 9:136328277-136328299 GCTCTGTGCCCCACGCCTTTGGG + Intronic
1062583980 9:137240797-137240819 GCTCTGAGCCCGGGGCCTTTCGG - Intergenic
1186854238 X:13610655-13610677 GCTTTGAGCACAGGTCCCTTGGG - Intronic
1187234391 X:17453285-17453307 CTTCTATGCACAGGTCCTTTGGG - Intronic
1189462561 X:41254019-41254041 GCTCTCTGTACTGGGCCCTTTGG + Intergenic
1192608696 X:72545991-72546013 ACACTGTGCACAGAGCCCTTTGG + Intronic
1192867899 X:75155496-75155518 TCTCTGTGCACAGGTCATTTTGG - Intronic
1201288293 Y:12397825-12397847 TATCTGTGCACAGGGGCTGTCGG + Intergenic