ID: 1178448121

View in Genome Browser
Species Human (GRCh38)
Location 21:32663930-32663952
Sequence GTCTATACACAGATGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178448119_1178448121 -9 Left 1178448119 21:32663916-32663938 CCTTACTAATTGCTGTCTATACA 0: 2
1: 37
2: 67
3: 34
4: 270
Right 1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178448121 Original CRISPR GTCTATACACAGATGATGAA GGG Intronic
900202099 1:1413075-1413097 GTCTACACATAGATGATCAGGGG - Intergenic
901079901 1:6578188-6578210 GTCCCTACAGAGATGGTGAAAGG - Intronic
904170348 1:28587745-28587767 GTCTACACATAGATGATCAGGGG - Intergenic
904324359 1:29718324-29718346 GACTTTACACAGATGTGGAATGG + Intergenic
904432228 1:30471666-30471688 TACTATACACAGAGGAGGAAGGG + Intergenic
906498957 1:46326396-46326418 GTCTACACATAGATAATCAAAGG - Intergenic
908704388 1:66935375-66935397 GACTGTACACAGAGTATGAATGG - Intronic
909523355 1:76594835-76594857 GGCTGTAGACAGATGAGGAATGG - Intronic
911006282 1:93228099-93228121 TTAGATACACAGGTGATGAAAGG + Intronic
911049374 1:93657209-93657231 GTCTCTACACAAATGCTGATGGG - Intronic
911183782 1:94883910-94883932 GAATATACACAGAGGAAGAAAGG - Intronic
911901997 1:103518122-103518144 ATCTACATACAGATGCTGAAAGG - Intergenic
912980112 1:114363779-114363801 GTCTACACATAGATGATCAAAGG - Intergenic
914683745 1:149959767-149959789 TGGTATACACAGAAGATGAATGG - Exonic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
916310800 1:163396804-163396826 ATATATACAAAAATGATGAATGG - Intergenic
916766830 1:167869037-167869059 GTCTACACATAGATAATCAAAGG + Intronic
918646774 1:186915190-186915212 GTCTACACATAGATGATCAAGGG - Intronic
919280352 1:195482176-195482198 GTGTATAGACTGAAGATGAATGG + Intergenic
920450554 1:206058049-206058071 GTCTACACATAGATGATCAGGGG + Intronic
922557377 1:226542703-226542725 GTCTGTGCACAGACGAGGAAAGG + Intergenic
923202342 1:231724605-231724627 GTCTATACACAGATGACTAAAGG - Intronic
923613174 1:235513211-235513233 GTCTGTAGAGCGATGATGAAGGG + Intergenic
1063612931 10:7578246-7578268 TGCAATACAGAGATGATGAAAGG - Intronic
1065802048 10:29361257-29361279 GTCTACACATAGATAATCAAAGG - Intergenic
1067827451 10:49588126-49588148 GTCTGTGCACTGATGAGGAAAGG - Intergenic
1069320055 10:67158535-67158557 GTCTACACATAGATAATCAAAGG + Intronic
1070361066 10:75689717-75689739 GTCTATGTGCAGATAATGAATGG - Intronic
1070362542 10:75704997-75705019 GTCTTTACCTAGATGATGGAAGG + Intronic
1071282625 10:84116353-84116375 GTCTACCCATAGATGATCAAGGG + Intergenic
1071288173 10:84168026-84168048 GTCTACACATAAATGATTAAGGG - Intergenic
1072126812 10:92453312-92453334 ATATAAACACAGATGATGACTGG - Exonic
1072335211 10:94391775-94391797 GTCTACACATAGATGATCAAGGG + Intergenic
1072688818 10:97556299-97556321 GTCTACACATAGATGATCACAGG - Intronic
1072804152 10:98414244-98414266 GTCTATACAGAGATAATGACGGG - Intronic
1077786132 11:5385332-5385354 GTCTATACAGAGACAATGACAGG - Intronic
1081099523 11:38985245-38985267 GCATATACACAAATGATAAAGGG - Intergenic
1081564391 11:44248536-44248558 GCCTGTTCACAGATGATGCATGG - Intergenic
1085240142 11:75046313-75046335 GTCTACACATAGACGATCAAGGG + Intergenic
1086231100 11:84570751-84570773 TTCTAAACTGAGATGATGAAGGG - Intronic
1086973061 11:93104340-93104362 GTCTACACATAGTTGATCAAGGG - Intergenic
1087872965 11:103321462-103321484 GTATATAGACAGATCTTGAAGGG + Intronic
1088304988 11:108398175-108398197 GTTTATACAGAGAAGACGAAGGG + Intronic
1090500142 11:127253062-127253084 GTATGGACACAGAAGATGAATGG + Intergenic
1091814101 12:3423193-3423215 GTCTACACATAGATGATCCAGGG - Intronic
1091969654 12:4775630-4775652 TTATATAGATAGATGATGAAAGG + Intronic
1092570273 12:9713955-9713977 GTCTACACATAGATAATCAAAGG - Intergenic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1093593702 12:20937852-20937874 GTCTACACATAGATGATCAAGGG - Intergenic
1094719711 12:33052044-33052066 GAGGATACACAGATGATAAATGG + Intergenic
1095485924 12:42684524-42684546 GGATATACACAGAGGATTAAGGG + Intergenic
1097745055 12:63292380-63292402 GAGTTTACAAAGATGATGAAGGG + Intergenic
1098248791 12:68547137-68547159 GTCTACACGTAGATGATCAAGGG + Intergenic
1098749048 12:74272217-74272239 GTCTACACATAAATGATGAAGGG + Intergenic
1099119435 12:78669665-78669687 GTGTATATACAGCTGATGACTGG - Intergenic
1100572233 12:95853636-95853658 GTCTCTCCACAGGTGCTGAAAGG + Intergenic
1101028118 12:100633861-100633883 GTCTACACATAGATGATCAAGGG - Intergenic
1105348007 13:19591429-19591451 GTGTAGACACAGCTGATGGAGGG - Intergenic
1105695972 13:22889001-22889023 GTCTATACATAGATAATCAAAGG + Intergenic
1106074072 13:26442187-26442209 CTCTATACACAGATCATGCCTGG + Intergenic
1106708181 13:32303513-32303535 TTATATATAGAGATGATGAAGGG - Intergenic
1107900973 13:45013347-45013369 GTCCAGACACAGAAGAGGAATGG + Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1109278535 13:60329326-60329348 GTTGATACACTGATGATAAAGGG + Intergenic
1109803394 13:67405080-67405102 GTCTACACATAGATAATCAAGGG + Intergenic
1109888230 13:68571686-68571708 CTCCATCCACAGATGTTGAAAGG + Intergenic
1111626973 13:90800299-90800321 GTCTTTTCACAGAACATGAAGGG - Intergenic
1112138867 13:96615498-96615520 GTCTACATCCAGATGATGAATGG - Intronic
1112167376 13:96933990-96934012 GTTTATTCACTGAAGATGAAGGG + Intergenic
1113139714 13:107133721-107133743 GTCTATACACAGAGCATCTATGG - Intergenic
1114041153 14:18679575-18679597 TTCTATACACTGAGGATGAGAGG + Intergenic
1114046179 14:18878030-18878052 TTCTATACACTGAGGATGAGAGG + Intergenic
1114118031 14:19641420-19641442 TTCTATACACTGAGGATGAGAGG - Intergenic
1115114579 14:29864551-29864573 GACAACACACTGATGATGAAGGG - Intronic
1119942678 14:78657655-78657677 GTCTCTGAACAGATGATTAATGG + Intronic
1120222956 14:81756208-81756230 GTCCATGCACAGATGAGGAGAGG - Intergenic
1120963168 14:90143442-90143464 TTCTTTACAAAGATGCTGAAGGG - Intronic
1127095819 15:55511513-55511535 GTCTACACGTAGATGATCAAGGG - Intergenic
1127534326 15:59875637-59875659 TTCTATCCACACAAGATGAATGG - Intergenic
1130290458 15:82595207-82595229 GTCTATTAACTGGTGATGAATGG - Intronic
1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG + Intronic
1135527661 16:23226510-23226532 GTCTTTACACTGAGTATGAAAGG + Intergenic
1137229215 16:46546909-46546931 TTCTATAAACATTTGATGAAAGG + Intergenic
1137424073 16:48362673-48362695 GTCTATCCAAAGACGATTAAGGG - Intronic
1138799371 16:60008338-60008360 TTCTATATAAAGATGATGGAAGG + Intergenic
1148828564 17:50413504-50413526 GCCTACACATAGATGATCAAGGG - Intergenic
1152131434 17:78479272-78479294 TTCTATACACAAATGATTTAAGG - Intronic
1152455353 17:80412689-80412711 GTCTACACATAGATGATCGAGGG + Intergenic
1153830771 18:8920527-8920549 GTCTACACATAGATGATCAAGGG + Intergenic
1155373718 18:25133511-25133533 GTCTATAATCAGATGATAAATGG - Intronic
1155730618 18:29153229-29153251 GTGTATACACAGAGAAAGAAGGG + Intergenic
1156037008 18:32775517-32775539 GTTTATGCACAGATTATGAAGGG - Intergenic
1156345687 18:36255335-36255357 GTCAAGAGACAGATGATGAAAGG - Intronic
1157515165 18:48305728-48305750 GTCTAAGCACACATGATGGAGGG - Intronic
1158292499 18:55957143-55957165 CTCTACACATAGATGATTAAGGG + Intergenic
1159395800 18:67854450-67854472 ATATAAACACAGAAGATGAATGG - Intergenic
1159584437 18:70270248-70270270 GTCAATACATAGCTGATCAATGG + Intergenic
1163896793 19:20066390-20066412 ATCTATGCACAGATGAGGAGAGG - Intergenic
1163934202 19:20426935-20426957 GTCTACACACAGATGATCAGGGG - Intergenic
1163935824 19:20442210-20442232 GTCTGTGCACAGATGAGGACAGG + Intergenic
1163942806 19:20510685-20510707 GTCTACACATAGATGACCAAGGG - Intergenic
1163992286 19:21009752-21009774 GTCTACACATAGATGACCAAGGG + Intergenic
1164216507 19:23155340-23155362 GTCTTCACATAGATGATCAAGGG - Intergenic
1167581665 19:50347836-50347858 GTCTCCACATAGATGATCAAGGG - Intronic
1167909958 19:52693618-52693640 GTCTACACATAGATAATCAAAGG + Intergenic
925568382 2:5282050-5282072 GTGTATACCCAGAAGACGAATGG - Intergenic
925616228 2:5746912-5746934 GGATATACTCAGATGAAGAAGGG - Intergenic
928632318 2:33206381-33206403 GTCTATAAAGAGATAATCAAAGG - Intronic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
931829086 2:66032020-66032042 GTCTCTACATAGAAGAAGAAAGG + Intergenic
932071275 2:68622842-68622864 GTCTATTGACTGATGATGAACGG - Intronic
932299782 2:70658168-70658190 GTCTCTATAAAAATGATGAAAGG + Exonic
935194654 2:100805559-100805581 GTATATACCCAGAAGAGGAATGG - Intergenic
935970971 2:108530626-108530648 GCCTATACATAGATAATCAAGGG + Intergenic
939569920 2:143829093-143829115 GTCTAATCAGAAATGATGAATGG - Intergenic
940567435 2:155385561-155385583 GTCTATAGCCACATTATGAAAGG + Intergenic
941161434 2:162039592-162039614 CTTCATACACTGATGATGAAAGG + Intronic
941902490 2:170691715-170691737 CTCATTAAACAGATGATGAATGG - Intergenic
942657282 2:178227035-178227057 GGCTACACACAAAAGATGAAAGG + Intronic
943913365 2:193596339-193596361 CCCTATACACAGAAAATGAAGGG + Intergenic
945020820 2:205569587-205569609 GTCTAGACACCCATGCTGAATGG + Intronic
945289951 2:208117040-208117062 GTGTACACACAGATGATCAAGGG + Intergenic
945654001 2:212601172-212601194 GTTTATAAACAGCTGGTGAACGG + Intergenic
946916871 2:224531989-224532011 GTCTAGCAACAGATGATGTAGGG + Intronic
1170400769 20:15980705-15980727 GTCTACACATAGATAATCAAAGG - Intronic
1176342998 21:5715416-5715438 GTCCATGCACAGATGAGGAGAGG - Intergenic
1176475252 21:7147567-7147589 GTCCATGCACAGATGAGGAGAGG - Intergenic
1176501829 21:7609040-7609062 GTCCATGCACAGATGAGGAGAGG + Intergenic
1176537319 21:8113485-8113507 GTCCATGCACAGATGAGGAGAGG - Intergenic
1177351868 21:19953479-19953501 GTCAATAAACAGATGCTGCAAGG + Intergenic
1177354916 21:19996000-19996022 GTCTACACATAGATGATCAAGGG - Intergenic
1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG + Intronic
1180464717 22:15600667-15600689 TTCTATACACTGAGGATGAGAGG + Intergenic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
1203242263 22_KI270733v1_random:29889-29911 GTCCATGCACAGATGAGGAGAGG - Intergenic
950814266 3:15682333-15682355 GTCTGTACTCAGATGGTGAGTGG - Intronic
952056785 3:29456826-29456848 GACAATACACAGGTGAAGAAAGG + Intronic
952589525 3:34933592-34933614 GTCTATTCACAGATCATGGGTGG - Intergenic
955499003 3:59565536-59565558 GTCTATACAGACATGAAGAAAGG - Intergenic
957964001 3:87298480-87298502 AATTATACAGAGATGATGAAAGG + Intergenic
960215290 3:115026754-115026776 CAATATACACAGGTGATGAAAGG - Intronic
962097764 3:132309575-132309597 GTCTACACATAGATGATTAAGGG + Intergenic
963582828 3:147147940-147147962 TTCTATACACAAATGATGGCTGG + Intergenic
963582999 3:147150380-147150402 GTATATACCCAGATGTTGAATGG - Intergenic
964521990 3:157580036-157580058 GTCTACACATAGATGTTCAAGGG - Intronic
964924422 3:161938276-161938298 GTCTACACATAGATGATCAAGGG + Intergenic
966376216 3:179298310-179298332 GTTTGTACACAAATGGTGAAGGG - Intergenic
966530488 3:180973306-180973328 CTCTGTACACAGTGGATGAAAGG + Intronic
969150516 4:5165146-5165168 GTCAAGGCCCAGATGATGAATGG + Intronic
971027672 4:22604606-22604628 GTCTACACATAGATAATCAAAGG + Intergenic
972275300 4:37551607-37551629 GTCTACACATAGATAATCAAAGG + Intronic
972883396 4:43454070-43454092 GTACATACACAAATGCTGAATGG + Intergenic
975206063 4:71645155-71645177 GTCTACACATAGTTGATCAAGGG + Intergenic
976989967 4:91353954-91353976 GCCTACACATAGATGATGAGGGG - Intronic
977043160 4:92039250-92039272 GTCTACACATAGTTGATCAAGGG - Intergenic
978310176 4:107378875-107378897 TTCTATAGACACAGGATGAAGGG + Intergenic
978668506 4:111216184-111216206 GTCTAAATACTGATGTTGAATGG + Intergenic
980073408 4:128266864-128266886 GTCTACACATAGATGATCAAGGG + Intergenic
980780552 4:137486209-137486231 GTCTACACATAGATGATCAAGGG + Intergenic
981520939 4:145661712-145661734 GTCAATACACAGAGGAGAAAAGG - Intergenic
982378852 4:154726077-154726099 GTATACACACACATCATGAATGG - Intronic
982752370 4:159177737-159177759 ATCTATACCCAAATGGTGAAGGG - Intronic
983322236 4:166210364-166210386 ATCTATTCTCAGATGAGGAATGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984609352 4:181820080-181820102 GTCTGTACACAGAAGATGAGTGG + Intergenic
984624431 4:181989645-181989667 GTCTATGCACATAAAATGAAAGG + Intergenic
986258267 5:6120275-6120297 GTCTCTCCACACATCATGAATGG + Intergenic
986390360 5:7280154-7280176 TTCTTTACACCAATGATGAATGG + Intergenic
989095639 5:37778885-37778907 GTCTACACATAGATGATCAAGGG - Intergenic
989301611 5:39901773-39901795 GTCTATGCAAAGATAAAGAATGG - Intergenic
989557966 5:42818947-42818969 TTCTACACACAGGTGATCAAGGG + Intronic
992294975 5:75318710-75318732 GTCCATGTACAGATGATGAGAGG - Intergenic
992989326 5:82268107-82268129 GTCTACACATAGATAATCAAAGG - Intronic
993320652 5:86464877-86464899 GTCTACACATAGATGATCAAGGG + Intergenic
993490936 5:88548132-88548154 CACTTTTCACAGATGATGAAGGG + Intergenic
994525559 5:100901424-100901446 GTCTTTAGAAAGGTGATGAATGG - Intronic
995474234 5:112531815-112531837 GTCTACACATAGATGATCAAGGG + Intergenic
995940690 5:117579307-117579329 GACTATAAAAAGATGATCAACGG - Intergenic
998115067 5:139530707-139530729 GTCTACACATAGATGATCAGGGG + Intronic
999391614 5:151196964-151196986 GTCCATCAACTGATGATGAATGG + Intronic
1000534808 5:162467010-162467032 GGCTACATACATATGATGAAAGG + Intergenic
1000604512 5:163313878-163313900 GTCTACACATAGATGATCAGGGG - Intergenic
1002407754 5:179049365-179049387 GTCTACACATAGATGATCAAGGG - Intergenic
1002998718 6:2311220-2311242 GTCTACACATAGATGATCAAGGG - Intergenic
1005293463 6:24401142-24401164 GTCCATACATAGATATTGAAAGG + Intergenic
1005462336 6:26080936-26080958 GTCTACACATAGATGATTAAGGG + Intergenic
1006570909 6:35003445-35003467 GTCTACACATAGATAATCAAAGG + Intronic
1008028318 6:46664212-46664234 CTCTATAGATAGATGAAGAATGG - Intronic
1013558921 6:111285008-111285030 GTCTACACATAGATGATCAGGGG - Intergenic
1013694960 6:112691140-112691162 TTATATACTCAGATGCTGAAAGG + Intergenic
1014546492 6:122742326-122742348 GTCTACACATAGATGATCAAGGG - Intergenic
1014916338 6:127153557-127153579 GTTTATAGTCAGAAGATGAAAGG - Intronic
1016216773 6:141613708-141613730 GTCTATAAACAGAGAGTGAAGGG - Intergenic
1018436921 6:163768838-163768860 GATTAGACATAGATGATGAAAGG + Intergenic
1019107692 6:169682307-169682329 GTCTCTGCACAGGTGAGGAATGG - Intronic
1020043443 7:5021691-5021713 GCCTATACATAGATAATCAAGGG - Intronic
1021849037 7:24790100-24790122 GTCTACATATAGATGATCAAGGG - Intergenic
1021880231 7:25088190-25088212 GTGACTATACAGATGATGAAAGG - Intergenic
1022029309 7:26478004-26478026 GTCTATAAAAAGAAGATGCAGGG + Intergenic
1022793405 7:33712032-33712054 GTTTCTACACAGATGCTGGAAGG - Intergenic
1024425614 7:49222718-49222740 GTAGATACACAGAAGATAAAGGG + Intergenic
1027362314 7:77422029-77422051 TTTAATACACAGATGATGATAGG + Intergenic
1027535183 7:79390914-79390936 GCCTCTACACAGATGATGGCTGG - Intronic
1027788744 7:82613217-82613239 GTCTATAGGCAGAAGATAAACGG + Intergenic
1030412062 7:109193091-109193113 GTCCATGCACAGATGAGGAGAGG + Intergenic
1031061346 7:117054854-117054876 TTCTTTACAAAGATGAAGAAAGG + Intronic
1032979263 7:137263354-137263376 GTCTACACATAGATAATCAAAGG - Intronic
1037905653 8:22714630-22714652 GTCGATACACAGTGGATTAATGG + Intronic
1038090071 8:24242514-24242536 GTCTACACATAGATGATCTAGGG + Intergenic
1039876604 8:41591788-41591810 GTCTACACATAGATGATCAAGGG - Intronic
1040374106 8:46806424-46806446 GGCTATAGACTGAAGATGAATGG + Intergenic
1043881118 8:85544332-85544354 GTATATTCACAGGTGCTGAAGGG + Intergenic
1044264757 8:90168192-90168214 GTCAACACAGAGATGATGCATGG + Intergenic
1044523765 8:93228847-93228869 TTCTTTTCACACATGATGAATGG - Intergenic
1044687700 8:94843657-94843679 CTGTATACACATATGATGGAGGG + Intronic
1045490456 8:102664543-102664565 GTCTATCCAGAGAAAATGAAAGG - Intergenic
1045918180 8:107498621-107498643 TTATATACACAGAACATGAAGGG - Intergenic
1045937576 8:107698631-107698653 GTATAAACACAAATGGTGAAAGG + Intergenic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1051320306 9:15896697-15896719 GTGTATACACAGATACTGAAGGG - Intronic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1052508478 9:29383843-29383865 GTCTATACATAGATGATCAAGGG + Intergenic
1053611815 9:39721518-39721540 GACTAGACTCAGATGAGGAAGGG + Intergenic
1053869855 9:42479517-42479539 GACTAGACTCAGATGAGGAAGGG + Intergenic
1054086440 9:60749637-60749659 GACTAGACTCAGATGAGGAAGGG - Intergenic
1054241706 9:62620875-62620897 GACTAGACTCAGATGAGGAAGGG - Intergenic
1054347056 9:63977623-63977645 ATCCAGACACAGAGGATGAAAGG + Intergenic
1054555832 9:66655398-66655420 GACTAGACTCAGATGAGGAAGGG - Intergenic
1055221700 9:73941188-73941210 GACTGGACACAGTTGATGAAAGG + Intergenic
1055673005 9:78626106-78626128 GTATATACACAGATGGTCATTGG - Intergenic
1058569072 9:106321222-106321244 GTATATGCTCAAATGATGAAAGG - Intergenic
1060579685 9:124734035-124734057 CTCTATACATCGTTGATGAAAGG + Intronic
1062415306 9:136446028-136446050 TGCTTTACACAGCTGATGAATGG + Intronic
1203458591 Un_GL000220v1:12966-12988 GTCCATGCACAGATGAGGAGAGG - Intergenic
1188335293 X:28924488-28924510 TTCTATCTACAGATGCTGAATGG + Intronic
1189050218 X:37637188-37637210 GTCTGAACACAGATGATGGAAGG - Intronic
1190270688 X:48860963-48860985 GTCTACACATAGATGATCAAGGG + Intergenic
1190425430 X:50330797-50330819 GTCTACACATAGATGATCAAGGG - Intronic
1190771688 X:53519940-53519962 GTCTACACCTAGATGATCAAGGG + Intergenic
1191102015 X:56740211-56740233 GTCTATAGAGAAATGATTAATGG - Intergenic
1191817825 X:65267487-65267509 GTCTATACACAGGGGAAAAAAGG + Intergenic
1191917564 X:66219363-66219385 GTCTACACATAGACGATCAAAGG - Intronic
1193070592 X:77301763-77301785 GCCTATACATAGATGATTAAGGG + Intergenic
1193717742 X:84951650-84951672 GTCTACACATAGATGATCAAGGG + Intergenic
1194494719 X:94600242-94600264 GTCCATGCACAGATGAGGAGAGG + Intergenic
1194950527 X:100120646-100120668 GTCTACATACAAATGATGAAGGG + Intergenic
1194955752 X:100178159-100178181 GGCCATAGTCAGATGATGAATGG - Intergenic
1196414338 X:115454837-115454859 AGCTTCACACAGATGATGAAGGG + Intergenic
1196459660 X:115917248-115917270 GTCTACACATAGATGATCAGGGG - Intergenic
1196469013 X:116004372-116004394 GTCTAAACAAAGATTGTGAAAGG + Intergenic
1198970463 X:142273097-142273119 GTCTACACATAGATGATCAAGGG + Intergenic
1199140966 X:144311827-144311849 CTCCATCAACAGATGATGAATGG + Intergenic
1200393678 X:155969761-155969783 GTCTACACATAGATGATCAAGGG - Intergenic
1201270704 Y:12251140-12251162 GTCTACACATAGATGATCAGGGG + Intergenic
1201297072 Y:12473035-12473057 GTCTACACATAGATGATCAAGGG - Intergenic
1201373305 Y:13288883-13288905 GTCTACACATAGATGATCAGAGG + Intronic
1201556619 Y:15269700-15269722 GTCTACACATTGATGATCAAGGG + Intergenic