ID: 1178451507

View in Genome Browser
Species Human (GRCh38)
Location 21:32705688-32705710
Sequence AGTGAACACCAACAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178451502_1178451507 1 Left 1178451502 21:32705664-32705686 CCATCACCTTTATCAAGTAATCA 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG 0: 1
1: 1
2: 0
3: 36
4: 238
1178451501_1178451507 10 Left 1178451501 21:32705655-32705677 CCTAGCAAACCATCACCTTTATC 0: 1
1: 0
2: 0
3: 13
4: 218
Right 1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG 0: 1
1: 1
2: 0
3: 36
4: 238
1178451503_1178451507 -5 Left 1178451503 21:32705670-32705692 CCTTTATCAAGTAATCAAAGTGA 0: 1
1: 0
2: 18
3: 93
4: 433
Right 1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG 0: 1
1: 1
2: 0
3: 36
4: 238
1178451500_1178451507 18 Left 1178451500 21:32705647-32705669 CCGACATGCCTAGCAAACCATCA 0: 1
1: 0
2: 1
3: 20
4: 395
Right 1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG 0: 1
1: 1
2: 0
3: 36
4: 238
1178451499_1178451507 19 Left 1178451499 21:32705646-32705668 CCCGACATGCCTAGCAAACCATC 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG 0: 1
1: 1
2: 0
3: 36
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178451507 Original CRISPR AGTGAACACCAACAGGGGCC TGG Intronic
901489963 1:9591628-9591650 AGTAAACACCAACAAAGCCCCGG - Intronic
902931581 1:19735223-19735245 AGTGTACCCAAACTGGGGCCAGG + Intronic
905013218 1:34760701-34760723 ACTGAACACCAACAAGAGCCTGG - Intronic
905089430 1:35416857-35416879 AGTTAATACCAACTGAGGCCAGG - Intronic
905156415 1:35987030-35987052 AGTAAACAGCAAAAGGGGCTAGG + Intronic
905465634 1:38151106-38151128 AGTGAATACCAGCAGGAGCCGGG + Intergenic
906280126 1:44547393-44547415 GGTGAACACCAACATGGACTTGG - Intronic
907176380 1:52527250-52527272 TTTAAAAACCAACAGGGGCCGGG + Intronic
907756120 1:57312579-57312601 AGGGAACATCACCAGGGCCCAGG + Intronic
911241336 1:95470823-95470845 AGTGAACATCAGCAGTGGCCTGG - Intergenic
912152795 1:106880421-106880443 AGTGAACCTCAGCAGTGGCCTGG + Intergenic
912316465 1:108671244-108671266 AGTGAAAATCAAGAGTGGCCTGG + Intergenic
912630910 1:111245985-111246007 AGCGGAGACCAACTGGGGCCTGG - Intergenic
915005458 1:152630782-152630804 AGTGAACATCATCAGTAGCCAGG + Intergenic
915810917 1:158909798-158909820 AGTGAACATCAGCAGTAGCCAGG + Intergenic
916553326 1:165871109-165871131 ACTAAACACTAACAGGGGCCAGG - Intronic
917306297 1:173628472-173628494 AGTGAATACCAGCAGTAGCCAGG + Intronic
918358042 1:183724504-183724526 AGTGAACATCAGCAGTAGCCTGG + Intronic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
921746182 1:218743087-218743109 AGTAAACATCAACAGTTGCCAGG + Intergenic
921794527 1:219326936-219326958 AGTAAACAACAGCAGGGGCCGGG + Intergenic
922445395 1:225692707-225692729 AGAGAATACCAACATGGGCTGGG - Intergenic
922622498 1:227000850-227000872 ATTGAACAGCAAAAGGAGCCTGG + Intronic
923102317 1:230826405-230826427 AGAGCACAGCAAGAGGGGCCTGG + Intergenic
923295858 1:232594424-232594446 AGTGAACACCGAGCGGAGCCAGG + Intergenic
923704392 1:236332238-236332260 CGTGAACACCGACAGAGGCTGGG + Intergenic
1064446631 10:15399381-15399403 AGTGAGCATTAACAGTGGCCTGG + Intergenic
1064987472 10:21225689-21225711 AGTGAACATCGGCAGTGGCCAGG - Intergenic
1068019650 10:51565370-51565392 AGAGAACAGCAGCAGGGGCTAGG - Intronic
1069343538 10:67440175-67440197 AGTGAACATCAGCAGTGGCCTGG + Intronic
1070687403 10:78498377-78498399 GGTGAAAAGCAACAGGGGGCTGG - Intergenic
1071798730 10:89034084-89034106 ACTGAACACCAACAGGCATCTGG + Intergenic
1071896694 10:90075809-90075831 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1071899322 10:90101848-90101870 AGTGAACACAAGCAGTAGCCAGG + Intergenic
1071928739 10:90441115-90441137 TGGGCACTCCAACAGGGGCCTGG + Intergenic
1072843069 10:98796362-98796384 AGTGAACATCAGCAGTGGCCTGG + Intronic
1074483595 10:113852039-113852061 AATAACCACCAACTGGGGCCGGG + Intronic
1075618770 10:123910455-123910477 TGGGAACTGCAACAGGGGCCGGG - Intronic
1075953951 10:126506336-126506358 AGTGAAGGCTAACAGGGTCCTGG + Intronic
1076187072 10:128458397-128458419 GATGATCACCAACAGGGGCAGGG + Intergenic
1076990599 11:271410-271432 AGTGAAGACCACCAGGGCCTGGG + Intergenic
1077315203 11:1916602-1916624 AGTGGACAGCACCAGGGGCAGGG + Intergenic
1078420346 11:11206625-11206647 AGTGAAAGTCAACAGGGCCCTGG - Intergenic
1079486373 11:20939830-20939852 AGTGAAGAGCAAATGGGGCCAGG + Intronic
1080650038 11:34215021-34215043 AGTCACCACCACCTGGGGCCAGG - Intronic
1080888598 11:36389065-36389087 AGTGCTCACCAACAGGGAACTGG - Intronic
1081212504 11:40354333-40354355 AGTGAACACTGGCAGGAGCCTGG - Intronic
1083214648 11:61210744-61210766 AGGGAACAAAAACAGGGTCCAGG - Intronic
1083217532 11:61229573-61229595 AGGGAACAAAAACAGGGTCCAGG - Intronic
1083220523 11:61249323-61249345 AGGGAACAAAAACAGGGCCCAGG - Intronic
1083563899 11:63696840-63696862 AGAAAATAGCAACAGGGGCCAGG - Intronic
1083623901 11:64062168-64062190 GCTGAGCACCCACAGGGGCCTGG + Intronic
1084927526 11:72525407-72525429 AAACAACAACAACAGGGGCCAGG - Intergenic
1085475613 11:76787020-76787042 AGTGAATACCAACATGTGCCAGG + Intronic
1087387416 11:97489400-97489422 AATGAATGGCAACAGGGGCCAGG - Intergenic
1088210866 11:107454155-107454177 AGTGAACACCAGCTGTAGCCAGG + Intronic
1089216541 11:116837694-116837716 AGTGAGCAGCAACAGGGCCGGGG - Exonic
1089946562 11:122480007-122480029 AGTGAACATCAGCAGAGGTCTGG + Intergenic
1089973433 11:122712525-122712547 AGCGAGCACCAACAGGACCCTGG - Intronic
1090065266 11:123498040-123498062 AGTGAACATCAGCAGTGGCCTGG - Intergenic
1092967381 12:13657524-13657546 AGAGCACACCAACAGGTGTCAGG - Intronic
1095917781 12:47497596-47497618 TGTGTACACCACCAGGGCCCTGG + Intergenic
1096430599 12:51539832-51539854 AGTAAACACCCGCATGGGCCGGG + Intergenic
1097238823 12:57559114-57559136 AATGTCCACCAACAGAGGCCTGG - Intronic
1097980901 12:65737294-65737316 AGTAAACAACAAAATGGGCCAGG + Intergenic
1098193655 12:67977041-67977063 AGCCAACACCACCAGGGCCCTGG - Intergenic
1099548381 12:84013007-84013029 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1100713859 12:97285381-97285403 AGTGAACACCAACAATGGGATGG - Intergenic
1103461428 12:121107918-121107940 TGTGAACATCAGCAGTGGCCTGG + Intergenic
1104782702 12:131432043-131432065 ATCAAACACCATCAGGGGCCAGG - Intergenic
1106992509 13:35439093-35439115 AGTGATTCCCAACAGGGGCAGGG + Intronic
1107210905 13:37852800-37852822 AGTGAACACTAGCAGTGGCCTGG + Intronic
1107500295 13:40966948-40966970 AGAAAACACCAAGAGGGGTCTGG + Intronic
1107774376 13:43822747-43822769 AGTGAACATCAGCAGTGCCCTGG - Intergenic
1107880856 13:44830806-44830828 ACTGAGGACCAACAGGGGACAGG - Intergenic
1108075698 13:46677073-46677095 AGTGAAAACCAACATAGGCCGGG - Intronic
1108532785 13:51343177-51343199 AGTGAAAACCAGCCGGAGCCAGG + Intronic
1109045874 13:57409881-57409903 AGTGAACATCAATAGTAGCCAGG + Intergenic
1110432664 13:75443142-75443164 AGTGAATGCCAACAGCGGCTAGG + Intronic
1111961038 13:94811032-94811054 AGTGGACACTAACAAGGGACAGG - Intergenic
1114506305 14:23217192-23217214 AGTTAACATCAGCAGTGGCCTGG + Intronic
1115620240 14:35133977-35133999 AGTGAACACAGACAGTAGCCAGG - Intronic
1118319201 14:64743343-64743365 CCTGAGCACCAAGAGGGGCCGGG + Exonic
1118835762 14:69476760-69476782 AGTGAGCGCGGACAGGGGCCAGG + Intergenic
1121124472 14:91397249-91397271 AGGGGACAGCCACAGGGGCCTGG + Intronic
1121467148 14:94123272-94123294 AGGAAACACCAACAGGGGAATGG + Intergenic
1122408182 14:101512608-101512630 AGGGAACACCATCAGCAGCCAGG - Intergenic
1124828669 15:33126378-33126400 AGTGTGCACCAAAAGGAGCCTGG + Intronic
1126660632 15:51030181-51030203 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1127177977 15:56382165-56382187 AGTGAACACTAGCAGTGGCCTGG - Intronic
1127726842 15:61758784-61758806 AGAGAGCACCAACAGGGGGCTGG + Intergenic
1127777308 15:62275211-62275233 AGTGTCCACCAACAGGGAACTGG - Intergenic
1128801829 15:70501948-70501970 AGTGAACACCAGAAAGGACCTGG + Intergenic
1129030577 15:72615012-72615034 AGTGAACATCGACAGTAGCCTGG - Intergenic
1129561798 15:76578041-76578063 AGTGAACACTGACAGTAGCCAGG + Intronic
1129642438 15:77393965-77393987 AGTGAACATCAGCAGTAGCCAGG + Intronic
1129837202 15:78716916-78716938 AGTGTCCACCAACAGGGAACTGG + Intronic
1130087285 15:80788069-80788091 TTTGCACACCGACAGGGGCCTGG - Intronic
1130267934 15:82425662-82425684 AGTGTCCACCAACAGGGAACTGG + Intergenic
1130504091 15:84521172-84521194 AGTGTCCACCAACAGGGAACTGG - Intergenic
1130919351 15:88331240-88331262 AATGACCACCAAGATGGGCCTGG - Intergenic
1133028933 16:3000640-3000662 AGCCAAGCCCAACAGGGGCCAGG + Intergenic
1133508779 16:6437984-6438006 AGTCAAGACCAAGAGGAGCCTGG - Intronic
1133834068 16:9351031-9351053 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1135684130 16:24484318-24484340 AGTGACCATAAACAAGGGCCTGG + Intergenic
1136866922 16:33766610-33766632 AATGCACCTCAACAGGGGCCTGG + Intergenic
1137466953 16:48718430-48718452 AGTGAACACCACAAGGGTCTCGG - Intergenic
1137500779 16:49010383-49010405 AATGAACCCCACCAAGGGCCAGG - Intergenic
1137713894 16:50585931-50585953 AAGGAACACCAACAGTGGACAGG - Intronic
1138068839 16:53970292-53970314 GGTGAAAAACAACAGGGGCTGGG + Intronic
1139573565 16:67827825-67827847 AGTGAACACCTACATGAGCCAGG + Exonic
1140113894 16:72025486-72025508 TGTGATCACCAACAGGGGACTGG - Intronic
1141008441 16:80374921-80374943 AGTGATCACCTACAGGAGCTGGG + Intergenic
1141485190 16:84334168-84334190 AGTGAACACCAGCAATGGCCTGG + Intergenic
1141868212 16:86765694-86765716 AGGAAACACCAACAGGGGAGTGG + Intergenic
1203105240 16_KI270728v1_random:1349592-1349614 AATGCACCTCAACAGGGGCCTGG - Intergenic
1203128274 16_KI270728v1_random:1612776-1612798 AATGCACCTCAACAGGGGCCTGG + Intergenic
1145104372 17:20103169-20103191 GCTGAAGACCAACAGGAGCCAGG - Intronic
1145274324 17:21420863-21420885 GTTGAGCACCAACTGGGGCCAGG - Intergenic
1145312184 17:21706767-21706789 GTTGAGCACCAACTGGGGCCAGG - Intergenic
1146050311 17:29545815-29545837 AGTGAACACCAACACTGGGAAGG - Exonic
1146589325 17:34114864-34114886 AGTGAAGTCCAGCAGGTGCCAGG + Intronic
1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG + Exonic
1149103593 17:52935637-52935659 AAAGAACAGCATCAGGGGCCTGG + Intergenic
1149998830 17:61419387-61419409 ATTGAACACCTACATGTGCCAGG - Intergenic
1150841149 17:68606827-68606849 AGTAAACATCTACTGGGGCCAGG - Intergenic
1151258676 17:72899664-72899686 AGAGAACGACAGCAGGGGCCGGG + Intronic
1151645625 17:75429206-75429228 ATTGAACACAAATAGAGGCCGGG + Intergenic
1151967224 17:77437707-77437729 AGTGAACCCCAGTAGTGGCCTGG + Intronic
1151999564 17:77637004-77637026 AATGGACACCTGCAGGGGCCGGG + Intergenic
1153429537 18:5000496-5000518 AGTGAACATCAACGGTGGCCTGG + Intergenic
1155282174 18:24250945-24250967 AGTGAACATCAGCAGTGGCCTGG + Intronic
1158611962 18:58949098-58949120 ACTGAACACCACCAGGTGCCAGG - Intronic
1159339648 18:67118807-67118829 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1160340726 18:78086797-78086819 AGTTGACAACAAGAGGGGCCTGG + Intergenic
1162992140 19:14310383-14310405 AATGAATACAAACAGCGGCCTGG - Intergenic
1163847372 19:19645355-19645377 CGGGAACCCCAACAGGGCCCCGG - Exonic
1165202202 19:34154260-34154282 AGTACACACCAACATGAGCCTGG - Intergenic
1166408283 19:42539451-42539473 AGTGAACATCAGCAGAGGACGGG - Intronic
1166757499 19:45202454-45202476 AGTGAACATCAGCAGTAGCCAGG - Exonic
1168045817 19:53793501-53793523 GGTAAATCCCAACAGGGGCCAGG - Intergenic
926879311 2:17525123-17525145 GGTGAAAAGCAACAAGGGCCTGG + Intergenic
928383918 2:30847537-30847559 AGTGAACACTGACAGTAGCCAGG + Intergenic
928965071 2:36967609-36967631 AGTGAAAACGGAGAGGGGCCAGG - Intergenic
929114750 2:38434707-38434729 ACTGAAGACCAACAGGCACCAGG - Intergenic
932921107 2:75916437-75916459 AGTGAACATCATCAGTGGTCTGG - Intergenic
935256078 2:101310826-101310848 AGGGAAAACCAACTGAGGCCTGG - Intergenic
935345368 2:102103203-102103225 AGTGAGCACTTACAGGTGCCAGG - Intronic
936938257 2:117858872-117858894 AGAGCCCACCAACAGGAGCCAGG - Intergenic
936938277 2:117858959-117858981 AGAGCCCACCAACAGGAGCCAGG - Intergenic
937216218 2:120315256-120315278 GGTGACCATCACCAGGGGCCAGG - Intergenic
937285989 2:120751638-120751660 AGAGAACACCAACGTGGGCCTGG - Intronic
938100308 2:128493564-128493586 AGTGAACGGCAACAGAGCCCAGG - Intergenic
940803028 2:158154128-158154150 AGTGAACATCAGCAGTAGCCAGG + Intergenic
942963196 2:181857912-181857934 AGGGATCACAAACAGGGGCAAGG - Intergenic
944963329 2:204901398-204901420 AATGAACACCAGCAGTAGCCAGG - Intronic
945739667 2:213644853-213644875 AGTGAACATAAGCAGTGGCCAGG - Intronic
946275062 2:218625386-218625408 AGGAAACACCAAGAGGGGTCGGG - Intronic
947311620 2:228809447-228809469 AGCCAACACCACCAGGGCCCTGG - Intergenic
948549677 2:238761984-238762006 AGTCAACACCAACAGAAGCTTGG + Intergenic
1173318125 20:41963185-41963207 AGTGAAAAGCAAGAGGGTCCTGG - Intergenic
1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG + Intronic
1179876047 21:44268053-44268075 AGTGAACCCCAACTATGGCCCGG - Intergenic
1180047691 21:45317363-45317385 AGTGCTCCTCAACAGGGGCCTGG + Intergenic
1182740501 22:32563962-32563984 CTTGAAACCCAACAGGGGCCGGG - Intronic
1183225781 22:36548997-36549019 AGTGAAGATCAACAGGGACGAGG - Intergenic
1184865787 22:47201302-47201324 AGAGAAGACCCACAGGGGGCAGG + Intergenic
950114352 3:10440955-10440977 ATTGAACACTAACAGCAGCCAGG - Intronic
950426573 3:12927719-12927741 AGTGTTCACCAAGAGGTGCCTGG - Intronic
951398741 3:22203671-22203693 AGTGAACATCAGCAGTGGCCTGG + Intronic
951436940 3:22676197-22676219 AGTGAACATCAATAGTAGCCAGG - Intergenic
952526417 3:34215367-34215389 TGTGAATAGCACCAGGGGCCAGG + Intergenic
956070845 3:65449477-65449499 AATGAACACAATCAGGGGCCAGG + Intronic
956285150 3:67600835-67600857 AGTGAAAAACAAAAGGAGCCTGG + Intronic
956293268 3:67684251-67684273 GATGAACAACAACAGGGCCCGGG - Intergenic
957009403 3:74986462-74986484 TGTGTACACCACCAGGGCCCTGG - Intergenic
957271453 3:78035652-78035674 AAGGAACACCCACAGGGGGCTGG - Intergenic
959113490 3:102149137-102149159 AGTGAACATCAACAGTAGCTTGG + Intronic
959389393 3:105755613-105755635 GGTGAACATCAACAGAAGCCAGG + Intronic
959704296 3:109325407-109325429 TGTGAAGAGCCACAGGGGCCAGG - Intergenic
961610028 3:128129483-128129505 ACTGTACACCTACAGGGACCAGG + Intronic
962015244 3:131432240-131432262 AGTGAACATCAGCAGTAGCCAGG + Intergenic
962998400 3:140653288-140653310 AGTGAACATCAGCAGTTGCCAGG + Intergenic
964189208 3:153982236-153982258 AATGGACACCAAAAGGGGGCAGG + Intergenic
964387259 3:156161238-156161260 GGTGAGCACCCCCAGGGGCCAGG - Intronic
965415145 3:168384175-168384197 AGTGAACATCAGCAGTGGCCTGG - Intergenic
965669995 3:171137771-171137793 AATGATCAGCAACAGGGTCCAGG + Intronic
966587776 3:181646497-181646519 AATGACTACCAACAGGGGACTGG + Intergenic
969435736 4:7188331-7188353 ACTGAACACCACCATGGGCTAGG - Intergenic
969567270 4:7985912-7985934 ATTGAACCCCCACAGGGGTCGGG + Intronic
970549101 4:17161737-17161759 AGTGAACACCAAAAGTGAGCAGG - Intergenic
970703541 4:18771562-18771584 AGTGCACACCAACAGGGCTGTGG - Intergenic
975863953 4:78706770-78706792 AGTGAACAAGAACAGGTTCCTGG - Intergenic
976943715 4:90738776-90738798 AGTGAACATCGACAGCAGCCAGG - Intronic
978615364 4:110588152-110588174 AGTGAACCCCAGGAAGGGCCTGG + Intergenic
986210251 5:5665138-5665160 TGTCAACATCAACAGGGGCTTGG - Intergenic
986331751 5:6721594-6721616 AGTGCACACCACCAGAGTCCAGG - Intronic
988608458 5:32703132-32703154 AGTGAACATCAGCAGTAGCCAGG - Intronic
991107429 5:62860743-62860765 AGTGAACATCAGCAGTAGCCTGG - Intergenic
991698811 5:69298307-69298329 AAAGTACAGCAACAGGGGCCGGG - Intronic
993287321 5:86016162-86016184 AATGAACATCAACAATGGCCTGG - Intergenic
994226220 5:97254292-97254314 AGTGAACATCAGTAGTGGCCTGG + Intergenic
996195846 5:120605992-120606014 AGTGCACACCAACAGAGGCAGGG + Intronic
996666603 5:126066924-126066946 TGTGAACATCAGCAGTGGCCTGG + Intergenic
996945062 5:129056415-129056437 AGTGAACATCAGCAGTAGCCAGG + Intergenic
996956485 5:129188515-129188537 AGTGAACTGCAGCAGTGGCCAGG + Intergenic
998291158 5:140916098-140916120 AGTGAACATCAGCAGTGGCCAGG - Intronic
1001851362 5:174969782-174969804 AGAGAACAAAACCAGGGGCCTGG - Intergenic
1001956191 5:175849740-175849762 CGTGAGCTCCAACAGGGCCCTGG + Intronic
1002956542 6:1870867-1870889 AGTAAACACAAACAGGGCCCAGG + Intronic
1003860975 6:10321521-10321543 AGTGCACACAAACACGGGGCAGG + Intergenic
1004821880 6:19376104-19376126 ATTTAACACCAACTTGGGCCAGG + Intergenic
1005157021 6:22819040-22819062 AGTGAACATCAGAAGTGGCCTGG - Intergenic
1005839523 6:29732890-29732912 AGAGAACAACAAAATGGGCCAGG + Intronic
1006462906 6:34173829-34173851 AGTGAACATCAGCAGTGGCCTGG - Intergenic
1006991076 6:38215419-38215441 AGTGAACAGCACCAGGGGACAGG + Intronic
1008493071 6:52106128-52106150 GATTAACACCAGCAGGGGCCAGG + Intergenic
1009388090 6:63111328-63111350 AGTGAACACCAGCGGTAGCCAGG - Intergenic
1009893823 6:69721899-69721921 AGTGAACATTAGCAGTGGCCTGG + Intronic
1010798140 6:80141614-80141636 TGTGAGCACCAATAGGGGCTTGG + Intronic
1012770662 6:103429468-103429490 AGTGCCCACCAACAGTGGACTGG + Intergenic
1014073887 6:117215161-117215183 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1015154781 6:130080531-130080553 AGTGAACAACAACAGGTTCCTGG + Intronic
1018211666 6:161488254-161488276 AGAGAACACCATGAAGGGCCAGG + Intronic
1018712078 6:166504427-166504449 AGTGGCTACCAACATGGGCCAGG + Intronic
1019170554 6:170131078-170131100 GGTGAGCAGCAGCAGGGGCCGGG - Intergenic
1019265560 7:115544-115566 AGTGAACAGCAAGACGGACCTGG - Intergenic
1019507453 7:1399514-1399536 AGAGAACCCCCACAGGGTCCAGG + Intergenic
1020812700 7:12865127-12865149 AGTGAACATCAGCAGTAGCCTGG + Intergenic
1024980147 7:55151578-55151600 AGTGAACATCAGCAGGGGCTGGG + Intronic
1027720697 7:81737953-81737975 AGTAAACTCCAACAGGTGCCTGG - Intronic
1033155074 7:138949841-138949863 AGCCAACCCCAGCAGGGGCCGGG + Intronic
1033299587 7:140175476-140175498 AGACAACACCAAACGGGGCCCGG + Intronic
1035019863 7:155794495-155794517 GGTGAACACCAACCAGGGCGAGG - Intergenic
1035754008 8:2017701-2017723 AGTGAACACTGACAGTAGCCAGG - Intergenic
1038554539 8:28498232-28498254 AGTGAGCAGCTTCAGGGGCCAGG - Intronic
1039559607 8:38502181-38502203 ACTGAGCACCTGCAGGGGCCAGG - Intergenic
1041372637 8:57178780-57178802 AGTGAAGACCAACCCGGGCGCGG - Intergenic
1041500389 8:58533439-58533461 AGTGAACATCTACAGTGGACTGG - Intergenic
1047322878 8:123804778-123804800 AATGTCCACCAACAGGGGACTGG - Intronic
1047456454 8:125017424-125017446 AGTGAACACCAGCAGCAGCCAGG - Intronic
1056843634 9:90018772-90018794 AGGGAACACCAAGTGGTGCCTGG - Intergenic
1059224608 9:112660065-112660087 AGTGAGCCCCCACTGGGGCCCGG + Exonic
1059555441 9:115276114-115276136 AGTGAACATCAGCAGTGGCCAGG - Intronic
1060084072 9:120680831-120680853 AATGAACATCGACAGTGGCCTGG - Intronic
1187109086 X:16277420-16277442 AATGAACACCAAAAGCGACCAGG - Intergenic
1187132815 X:16518631-16518653 AGTGAACATCAGCAGTAGCCAGG + Intergenic
1187544070 X:20230185-20230207 ATTGAACACCAACTGGGTACTGG + Intronic
1188147318 X:26630068-26630090 AGTGCACACCAACAGGGTTGTGG + Intergenic
1188854209 X:35171995-35172017 AGTGAACATCAGCAGTGGCCTGG - Intergenic
1188999064 X:36923317-36923339 AGTGAACATCAACAGTAGCCTGG - Intergenic
1190122299 X:47672256-47672278 AATGAACATCAACAGTAGCCAGG - Intergenic
1190581324 X:51894785-51894807 AGTGGGCACGAACAGGAGCCGGG - Exonic
1190588111 X:51967592-51967614 AGTGAACACTGGCAGTGGCCTGG - Intergenic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1191116703 X:56860366-56860388 AGTGAACATCAGCAGTAGCCAGG - Intergenic
1191177091 X:57516185-57516207 AGAGAACAAAACCAGGGGCCTGG - Intergenic
1192069666 X:67923547-67923569 AGTGAACATCAGCAGTAGCCAGG + Intergenic
1193092605 X:77510631-77510653 AGTGAACATCAGCAGTAGCCAGG + Intronic
1194196670 X:90903095-90903117 AGTGAACATCAGCAGTGGACTGG - Intergenic
1194288494 X:92039520-92039542 AGTGAACATTAGCAGTGGCCTGG - Intronic
1194389263 X:93295463-93295485 AGTGAACACAGACAGTAGCCAGG + Intergenic
1194892503 X:99397943-99397965 AGTGAGCATCAGCAGTGGCCTGG - Intergenic
1196270030 X:113699444-113699466 AGTGAACGTCAGCAGTGGCCTGG - Intergenic
1196708525 X:118738611-118738633 AGTGCCCACCAACAGTGGACTGG - Intronic
1197623506 X:128778842-128778864 AGTGAACACCAACAGTGGCCTGG - Intergenic
1198773587 X:140156168-140156190 AGTGAACATCAGCAGTAGCCTGG + Intergenic
1198775695 X:140176732-140176754 AGTGATCCCCAGCAGGGCCCTGG - Intergenic
1199393718 X:147309896-147309918 AGTGAACATCAGAAGTGGCCCGG + Intergenic
1199412981 X:147546706-147546728 ATTGAATACCAACAAGGGCTTGG + Intergenic
1200542516 Y:4477296-4477318 AGTGAACATCAGCAGTGGACTGG - Intergenic
1200606013 Y:5264085-5264107 AGTGAACATTAGCAGTGGCCTGG - Intronic
1201421490 Y:13804635-13804657 AGTGAGCAGCAATAGGTGCCTGG - Intergenic
1201566094 Y:15366741-15366763 AGTGGACACCAACAAGGACAAGG + Intergenic
1202365815 Y:24163424-24163446 AGTGTCCACCAACAGGGAACTGG + Intergenic
1202504967 Y:25506698-25506720 AGTGTCCACCAACAGGGAACTGG - Intergenic