ID: 1178451555

View in Genome Browser
Species Human (GRCh38)
Location 21:32705978-32706000
Sequence TTGCTGTTGTTGTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6733
Summary {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178451555_1178451558 4 Left 1178451555 21:32705978-32706000 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1178451558 21:32706005-32706027 AAGTGAACACCAACAGTAAGAGG 0: 1
1: 0
2: 1
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178451555 Original CRISPR TTGCTGTTGTTGTTGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr