ID: 1178453782

View in Genome Browser
Species Human (GRCh38)
Location 21:32728216-32728238
Sequence TCTCCCTGCACCCCCGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178453782_1178453789 11 Left 1178453782 21:32728216-32728238 CCACCGCCGGGGGTGCAGGGAGA 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1178453789 21:32728250-32728272 GCCTCCTTGGTCCTTTTGCGTGG No data
1178453782_1178453791 12 Left 1178453782 21:32728216-32728238 CCACCGCCGGGGGTGCAGGGAGA 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1178453791 21:32728251-32728273 CCTCCTTGGTCCTTTTGCGTGGG No data
1178453782_1178453788 -2 Left 1178453782 21:32728216-32728238 CCACCGCCGGGGGTGCAGGGAGA 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1178453788 21:32728237-32728259 GAGGGAAGATCTGGCCTCCTTGG 0: 1
1: 0
2: 4
3: 33
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178453782 Original CRISPR TCTCCCTGCACCCCCGGCGG TGG (reversed) Intergenic