ID: 1178453782

View in Genome Browser
Species Human (GRCh38)
Location 21:32728216-32728238
Sequence TCTCCCTGCACCCCCGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178453782_1178453789 11 Left 1178453782 21:32728216-32728238 CCACCGCCGGGGGTGCAGGGAGA 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1178453789 21:32728250-32728272 GCCTCCTTGGTCCTTTTGCGTGG No data
1178453782_1178453791 12 Left 1178453782 21:32728216-32728238 CCACCGCCGGGGGTGCAGGGAGA 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1178453791 21:32728251-32728273 CCTCCTTGGTCCTTTTGCGTGGG No data
1178453782_1178453788 -2 Left 1178453782 21:32728216-32728238 CCACCGCCGGGGGTGCAGGGAGA 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1178453788 21:32728237-32728259 GAGGGAAGATCTGGCCTCCTTGG 0: 1
1: 0
2: 4
3: 33
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178453782 Original CRISPR TCTCCCTGCACCCCCGGCGG TGG (reversed) Intergenic
900449326 1:2697796-2697818 GCACCCTGCACCCCCGGGTGAGG + Intronic
900452794 1:2758747-2758769 GCACCCTGCACCCCCGGGTGAGG + Intronic
900488524 1:2934968-2934990 ACTCCCAGCACCCCCGGTGTGGG - Intergenic
900584273 1:3424927-3424949 TCTCCCTGGCCCCCAGGCCGCGG - Intronic
901292190 1:8132764-8132786 TGTCCCTGCACCCCCATCAGAGG - Intergenic
901302736 1:8211339-8211361 GCTCCCTGCACCGCCTGCGTGGG - Intergenic
901928022 1:12579247-12579269 GCTCCCTGCACGCCCGGGGCTGG + Intronic
902477598 1:16696552-16696574 TCCAGCTGCACCCCCGGCGCAGG + Intergenic
903264018 1:22145742-22145764 TCTCCCAGCACCCCAGGAGAAGG - Intergenic
904003392 1:27350936-27350958 TCCCCCTGCAGCCCCGGGTGAGG + Exonic
905891529 1:41521400-41521422 CCTCCCTGCACCCCCGTGGCGGG - Intronic
910254109 1:85230130-85230152 TCTCCCATCACCCCCGGATGCGG + Intergenic
922581788 1:226703580-226703602 TCTCCCGGCATGCTCGGCGGCGG + Intronic
924567666 1:245211907-245211929 TCGGCCTGCACCCACGGCAGTGG + Intronic
924730159 1:246703807-246703829 GCTCCCTGCACTCCCGGCCCTGG + Intergenic
1062875889 10:942826-942848 CCTCCCTGCACCCCTGGGAGAGG + Intergenic
1063980954 10:11451595-11451617 TCTCCCTGCCGCCCTGGCCGTGG + Intergenic
1064662057 10:17616920-17616942 GCTCCATTCAACCCCGGCGGTGG + Intronic
1065390124 10:25174755-25174777 TCTCCCTGCTCCCTCCTCGGGGG - Intergenic
1068216755 10:53991224-53991246 TCTGCCTGCAGCCCCGGCGTGGG + Intronic
1069855777 10:71440189-71440211 AGTCCCTGCACCCCAGGAGGAGG - Intronic
1070753668 10:78978292-78978314 TCTCCCTCCACCCTGGGCTGGGG + Intergenic
1070899267 10:80013865-80013887 TCTCCCTGCACACCCTGGGTAGG + Intergenic
1071429423 10:85595108-85595130 TCTCCCTGCACCCCTTGCCCAGG + Intergenic
1073184811 10:101609494-101609516 TCTCACGGCACCCCCTGTGGTGG - Exonic
1075653758 10:124147534-124147556 TCTGCCTGAACCCCAGGAGGTGG - Intergenic
1076061988 10:127420170-127420192 TCTCCGTGCACCTCTGGCGGTGG + Intronic
1076279343 10:129232533-129232555 TCTTCCTGCACCCCGGGCAGGGG - Intergenic
1076705046 10:132296930-132296952 CTTCCCTGCACCCCCTGCCGTGG - Intronic
1077352602 11:2099852-2099874 TCTCACTGCAGCCCTGGTGGAGG + Intergenic
1077554373 11:3218888-3218910 ACTCCCTGTGCCCCCAGCGGGGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083298969 11:61730361-61730383 GCTCCCTGCAGCCCTGGGGGCGG - Intronic
1083583397 11:63839372-63839394 CCTCCCCGCACCCCCGGCCGGGG + Exonic
1085508788 11:77074861-77074883 TCTCCCTTCACCCCCACCAGTGG + Intronic
1087441112 11:98185163-98185185 TCTGCCTGCAGCCCCAGCGCAGG - Intergenic
1088285381 11:108182318-108182340 TCTCCCTGCACACCCTGGGTAGG + Intronic
1089652181 11:119921650-119921672 GCTCCTTGCACCCCAGGCTGTGG + Intergenic
1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG + Intronic
1092572347 12:9739518-9739540 TCTACCTGCAGCCCCGGTGTGGG - Intergenic
1092732530 12:11547660-11547682 TCCACCTGCAGCCCCGGTGGGGG + Intergenic
1098318258 12:69214689-69214711 TCTTCCTGCTCCCTGGGCGGTGG + Intergenic
1099854229 12:88142903-88142925 TCTCTCTCCACCCCCGGCAGTGG - Intronic
1101874662 12:108590240-108590262 TCTCCAAGCACCCCCGGCCTGGG - Exonic
1102094482 12:110225897-110225919 ACTCACTGCAACCCAGGCGGAGG - Intergenic
1102111904 12:110371353-110371375 TCTCCCTGCAGCCACAGCTGGGG - Intergenic
1102318069 12:111905736-111905758 TGTCACTGCACCCCCAGTGGTGG + Intergenic
1103086642 12:118066536-118066558 TCCACCTGCACCCCTGGCGGGGG - Exonic
1103239609 12:119402090-119402112 TCTCCCTGCAGCCAGGGAGGTGG + Intronic
1104724154 12:131065887-131065909 TCTTCCTCCACCCCCGGAGAGGG - Intronic
1106221250 13:27748261-27748283 TCCACCTGCAGCCCCGGCGCGGG - Intergenic
1106827784 13:33542844-33542866 TCTCCCGCCACCCGCGGAGGTGG + Intergenic
1113955427 13:114097928-114097950 TCTCCCTGGACCCCCTGTGGTGG - Intronic
1114658777 14:24331812-24331834 GCTCCCTGCACTCACGCCGGCGG - Exonic
1115916372 14:38320298-38320320 TCTCCCTGCACCCCCACCTATGG + Intergenic
1118215298 14:63803212-63803234 TCCACCTGCAGCCCCGGTGGGGG - Intergenic
1122786147 14:104164143-104164165 TCTCGCTGCCCCCACTGCGGCGG - Intronic
1125830998 15:42717093-42717115 TCTTCCTGCACACCCAGCAGAGG - Intronic
1128930833 15:71703686-71703708 TCTCCATCCACCCCAGGCTGTGG - Intronic
1129550704 15:76445799-76445821 TCTCCATGCACCCCGGGTGGAGG + Intronic
1129933908 15:79433246-79433268 GCTCCCCGCACCGCCGGCGAGGG - Intronic
1130719371 15:86371922-86371944 TCTGCCTGCACTCCCGGCAGTGG + Intronic
1131367900 15:91854636-91854658 TCCCCCTGCAGCCCCGGCTCAGG - Intronic
1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG + Intergenic
1132681291 16:1143116-1143138 GGTCCGTGCACCCCAGGCGGCGG + Intergenic
1133858814 16:9574913-9574935 CCTCCCTGCACCTCATGCGGTGG - Intergenic
1138529437 16:57627102-57627124 CCTCCCTGCACCCCACGGGGTGG + Intronic
1139546858 16:67653548-67653570 TCTCTCAGCAGCCCCGGGGGAGG - Intronic
1140858760 16:79000982-79001004 TCTTCTTGGACCCCAGGCGGTGG - Intronic
1141079240 16:81036047-81036069 TGTCCCCGCGCCGCCGGCGGGGG + Exonic
1141834625 16:86530514-86530536 ACTCCCTGCCCCACCGGCAGTGG - Exonic
1142120446 16:88383988-88384010 TGTCCCTGCACCCTGGGCCGAGG + Intergenic
1142230971 16:88900157-88900179 ACTCCCTGCACCCGCGGGGCCGG - Intronic
1142246634 16:88973201-88973223 TCACTCTGCACTCCAGGCGGTGG - Intronic
1142271926 16:89094199-89094221 TCTCCCCGCACCCCGCGCGGGGG - Intronic
1142309723 16:89305457-89305479 CCTCCCTGCACCCCAGGGCGTGG + Intronic
1142364324 16:89641970-89641992 TCTGCCTGCACCCCAGGATGGGG - Intergenic
1143202721 17:5123284-5123306 TTTCCCCGCACCGCCGGTGGGGG + Intronic
1146906805 17:36623154-36623176 TCTCCCTGCAGCCTCTGCCGGGG + Intergenic
1147662728 17:42125671-42125693 TCCCCCTGCCCCCCCAGTGGTGG + Exonic
1148745511 17:49915933-49915955 TGTCCCTCCACTCCCAGCGGAGG + Intergenic
1149583447 17:57767769-57767791 CATCCCTGCCCCACCGGCGGTGG - Intergenic
1150778352 17:68099693-68099715 TCCACCTGCAGCCCCGGTGGGGG + Intergenic
1151441704 17:74133506-74133528 TCTCCCTGCCCCCCAGGCCAGGG + Intergenic
1152092465 17:78254539-78254561 GCTCCCTGGACCCCCGGCCCAGG - Intergenic
1152167990 17:78723359-78723381 TCTCCCTGCACCTACAGCTGTGG - Intronic
1152209699 17:78996508-78996530 TCTCCCTGAACCCCAGCAGGGGG - Intronic
1152618016 17:81346559-81346581 GCTCCCCGCACCCCCGACGCGGG - Intergenic
1152659169 17:81534538-81534560 TCTCCCAGGACCCCTGGGGGAGG - Intronic
1152741448 17:82020189-82020211 TCTCCCTGGAGCCCCAGCAGCGG - Intronic
1152758677 17:82097618-82097640 CCTCCCTTCGCCCCGGGCGGGGG + Intronic
1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG + Intergenic
1158901982 18:61972561-61972583 TCTCCCAGCACCCCAGGAGAAGG + Intergenic
1159670088 18:71212343-71212365 TCCCCCTGCAGCCCCGGTGCAGG - Intergenic
1160577242 18:79863677-79863699 TGGCCCTGCTCCCCGGGCGGCGG + Exonic
1160733636 19:652122-652144 TCTCCCTGCCCGCACGGCGGAGG - Intronic
1160895779 19:1401252-1401274 TTCCCCTGCGCCCCCGGGGGCGG + Intronic
1161139423 19:2638726-2638748 TCTCCCAGCATCCCCTGGGGAGG + Intronic
1161306925 19:3573589-3573611 TCTCGCTGCAGCCCCGCCGTCGG + Intronic
1161320356 19:3638095-3638117 TCACCCTGCACCCCCTGGGAAGG - Intronic
1161355829 19:3819224-3819246 TCTCCCCACAGCCCGGGCGGCGG - Exonic
1161403376 19:4078627-4078649 TCCCCCAGAACCCCCAGCGGAGG + Intergenic
1161770556 19:6228647-6228669 TCTCCCAGCACCCACGGCGGGGG + Intronic
1162097833 19:8321399-8321421 TTTCCCAGCAGCCCCAGCGGTGG - Intronic
1162100493 19:8335740-8335762 GCTGCGTGCGCCCCCGGCGGCGG + Exonic
1163651440 19:18520688-18520710 TCTCCCTCCTCCCCCGCCCGCGG + Intronic
1164892525 19:31836986-31837008 TCTCCCAGCACACCTGGCAGGGG - Intergenic
1168317290 19:55489860-55489882 TGTCCCTGCCCCCCCGCCGCAGG + Exonic
1202711618 1_KI270714v1_random:22378-22400 TCCAGCTGCACCCCCGGCGCAGG + Intergenic
925088621 2:1134673-1134695 TCCACCTGCAGCCCCGGTGGGGG - Intronic
927652292 2:24920040-24920062 CTCCCCTGCACCCGCGGCGGCGG + Intergenic
927751343 2:25673349-25673371 TCTCCCCACAGCCCCGGCGGCGG + Intronic
929811266 2:45190913-45190935 TCTGCCTGCAGCCCAGGAGGGGG - Intergenic
931653842 2:64492035-64492057 TCTCCCCGCACCCCCGCCCTTGG - Intergenic
933726652 2:85430957-85430979 TCTCCCAGCACCCCCGCCCTTGG - Intronic
940830071 2:158457042-158457064 TCTCCCACCACCCCCGGCGGCGG - Intronic
941712049 2:168724845-168724867 TCCACCTGCAGCCCCGGTGGGGG - Intronic
945995268 2:216431080-216431102 TCTCCCTGCAGCCTGGGCGGGGG - Intronic
948259754 2:236594839-236594861 TCTTCCAGCACCCCCGCAGGTGG - Intergenic
949028364 2:241776753-241776775 TCTCCCCGCACCTCCATCGGAGG - Intergenic
1169135466 20:3194646-3194668 TCTCCCTCCAACCCCGAAGGTGG - Intronic
1169210928 20:3765944-3765966 TCTTCCTGCACCCTGGGCTGGGG - Intronic
1170630017 20:18057756-18057778 TCTTCCTCCACCCCCCGCCGCGG + Exonic
1174287764 20:49484187-49484209 TCCTCCTGCTCCCGCGGCGGCGG + Intergenic
1175810391 20:61854507-61854529 TCACACTGCACCCCTGGGGGTGG - Intronic
1175810496 20:61854920-61854942 TCACACTGCACCCCTGGGGGTGG - Intronic
1175810509 20:61854966-61854988 TCACACTGCACCCCTGGGGGTGG - Intronic
1175810548 20:61855104-61855126 TCACACTGCACCCCTGGGGGTGG - Intronic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1178939406 21:36892377-36892399 TCTCCCTGCACCCCCTGCACTGG - Intronic
1179785693 21:43728534-43728556 TCACCCTGCCTCCCCGGAGGAGG + Intronic
1180625341 22:17190358-17190380 TCTCCCTGCATCTCTGTCGGGGG + Intronic
1181450472 22:23017000-23017022 TCCACCTGCAGCCCCGGCGCGGG - Intergenic
1182749001 22:32626967-32626989 TCTCCCTGCACCCCCAGCTTTGG + Intronic
1183002663 22:34874612-34874634 CCCCCCTGCACCCCCAGAGGTGG - Intergenic
1183519866 22:38290629-38290651 TCTCCCTGCAGACCCGGAAGTGG - Intergenic
1183741458 22:39670783-39670805 TCCCCCTGCACCACCTGCAGAGG + Exonic
1184131316 22:42518341-42518363 TCTCCCTGCACCGCCTTGGGAGG - Intronic
1184141538 22:42580553-42580575 TCTCCCTGCACCGCCTTGGGAGG - Intergenic
950249204 3:11449973-11449995 TCTCTCTGTACCCCTGGCAGGGG + Intronic
952301894 3:32110738-32110760 CCTCCCTGCACCTGCGGCAGTGG - Intronic
952534341 3:34294445-34294467 TCTACCTCCACCCCCAGAGGGGG + Intergenic
953929564 3:46999162-46999184 CCTCCCTGAACCCCAGGCAGGGG - Intronic
954423659 3:50432111-50432133 TCTCCCTGCACCCCCCTTGCTGG - Intronic
954714920 3:52522182-52522204 GCTCGCTGCAGCCCCCGCGGTGG - Exonic
958022712 3:88016101-88016123 TCCACCTGCAGCCCCGGTGGGGG + Intergenic
961371882 3:126436211-126436233 TCTCCCTGCACCAGGGGCAGGGG + Intronic
961647143 3:128398628-128398650 TGTCCCTGCAGGCCCGGCAGGGG - Intronic
967957053 3:194885399-194885421 TCTCTCTGCTGCCCCGGCTGTGG - Intergenic
968412740 4:403947-403969 TCCACCTGCAGCCCCGGCGCGGG - Intergenic
968490625 4:888959-888981 TCTCCCTGCAGGCCTGGCGCTGG - Exonic
968500210 4:946386-946408 TCACCCTGCACCCGAGGTGGAGG - Intronic
968726983 4:2252340-2252362 TGTCCCTGCACGCCCTGGGGGGG - Intronic
968899067 4:3422360-3422382 TCTCGCTGCTCCCCAGTCGGAGG + Exonic
968936713 4:3614843-3614865 TCTCCCTGCCCCCCGGGAGGTGG + Intergenic
969525833 4:7703608-7703630 CCTCCCTGCTCCCCAGGCTGGGG - Intronic
969593059 4:8132793-8132815 TCTCCCTGCAGCCCAGTCCGTGG - Intronic
969623293 4:8289734-8289756 CCTCCCTGCACCCAAGGAGGGGG - Intronic
969673367 4:8601793-8601815 GCTCACTGCACCCTGGGCGGGGG - Intronic
969694092 4:8725170-8725192 TCTCCCTGCAAACCCGGCATTGG - Intergenic
970333080 4:15003940-15003962 TCTGCCACCACCCCGGGCGGCGG + Exonic
973039868 4:45457064-45457086 TCTGCCTGCAGCCCCGGTGCAGG - Intergenic
974839719 4:67286643-67286665 TCTGCCTGCAGCCCTGGCAGTGG - Intergenic
975882634 4:78928880-78928902 TCTCCCATCACCCCCAGAGGGGG - Intronic
976733136 4:88284137-88284159 GCTGCCTGCGCCCCGGGCGGCGG - Intronic
979857442 4:125651710-125651732 TCCACCTGCACCCCCGGTGTGGG - Intergenic
980827297 4:138088676-138088698 TCTCCCCGCTCCCCCGCCGTGGG - Intergenic
982017890 4:151174168-151174190 TCTCCCAGCACTCCCAGCTGAGG + Intronic
982072170 4:151705135-151705157 TCTCGCACCACCCCCGGCTGTGG + Intronic
984776035 4:183482635-183482657 TCCACCTGCAGCCCCGGTGGGGG - Intergenic
985537581 5:473603-473625 TGTCCCGGGACCCCCGGCGGGGG - Intronic
989103485 5:37840226-37840248 TCTCCCTGCAGCCCAGGGAGGGG - Intergenic
989501226 5:42170583-42170605 TCTACCTGCACCCCCACAGGGGG + Intergenic
992497503 5:77308335-77308357 TCTACCTGCACTACCGGCGTGGG - Intronic
995764593 5:115602048-115602070 CCACCCCGCGCCCCCGGCGGCGG + Intronic
995805801 5:116051238-116051260 TCTCCTGGAACCCCCGGCAGAGG + Intronic
996016989 5:118550401-118550423 GCTCCCTGCACCCACGCCTGGGG + Intergenic
997228774 5:132228204-132228226 TCTCCCTACAGCCCCGGCGAGGG - Intronic
1001725208 5:173890622-173890644 TCTTCCTGGAGCCCGGGCGGTGG + Exonic
1002898581 6:1392986-1393008 TCTCCCTGGAGCGCCAGCGGTGG + Intronic
1005332807 6:24765882-24765904 TCCACCTGCAGCCCCGGCGCGGG - Intergenic
1006581796 6:35081662-35081684 TCTGCCTGCAGCCCCGTGGGGGG + Intronic
1007499043 6:42281269-42281291 TCTCCCTGCAGCCCAGGCTCCGG - Intronic
1015799270 6:137044466-137044488 GCTCCCTGCAGCCCCGGGGCTGG + Intronic
1017886512 6:158604178-158604200 TCTCCCTGGACTCCCAGCCGTGG + Intronic
1017914207 6:158819166-158819188 TCGCCCGGCACCCCCGGGGCAGG - Intronic
1018753242 6:166825680-166825702 TCTCCCTGTGTCCCCGGTGGTGG + Intronic
1018847820 6:167567334-167567356 GCTCTCTGCAGCCCAGGCGGTGG + Intergenic
1019517342 7:1445887-1445909 CCACCCTGCACCCCGGGTGGGGG - Intronic
1023093762 7:36640130-36640152 TTTCCCTGCAGCCCCGGCCCTGG - Intronic
1023628311 7:42138556-42138578 TTTCCCTTCACCCCTGGGGGAGG + Intronic
1024059430 7:45686839-45686861 ACTCCCTGCACCCCCAGCATAGG - Intronic
1026000893 7:66558351-66558373 ACTCCCTGCACCCCCTGCCTAGG + Intergenic
1034460047 7:151193114-151193136 TCCCCCTGCAGCCCCTGTGGTGG - Intronic
1035476271 7:159145662-159145684 TCTCCCCGCAAACGCGGCGGCGG + Intergenic
1035810370 8:2486168-2486190 TCTCTCTCCACCCACTGCGGTGG + Intergenic
1036671604 8:10792184-10792206 TCTCCCTGCACTCTCCGCGCTGG + Intronic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1039060285 8:33567037-33567059 TTTCCCTCCTCCCCCGGCCGAGG - Exonic
1039417225 8:37406120-37406142 TCACCATGCACCCCAGGAGGAGG + Intergenic
1045117371 8:98998045-98998067 TCTCCCAGCACCACCTGCAGGGG + Intergenic
1046094356 8:109539886-109539908 CCTCCCCGCCCGCCCGGCGGAGG - Intronic
1046643233 8:116755726-116755748 TTTCCCTGCTGCGCCGGCGGTGG + Exonic
1048310727 8:133320652-133320674 CCTCCCTGCCCCCTCGGTGGTGG + Intergenic
1049164595 8:141118140-141118162 TCTCACTGCACCCAGGGCAGAGG - Intronic
1049290128 8:141797444-141797466 CCTCCCTGCCCCCCCAGTGGAGG + Intergenic
1050472539 9:6008029-6008051 TCTCCCCTCCCCCCCGGCGGCGG + Intergenic
1053411265 9:37917539-37917561 TCACCCTCCTCCCCCGCCGGAGG + Intronic
1054781998 9:69174205-69174227 TGTCCCTCCTCCCGCGGCGGCGG - Intronic
1054981353 9:71210259-71210281 TCTCCCATCACCCCCGGATGGGG + Intronic
1060035082 9:120248288-120248310 TCTTCCTGCACCCCCTGCCCCGG - Intergenic
1060059686 9:120448039-120448061 TCTCCCTGCCACCCAGGAGGTGG - Exonic
1060722701 9:125989355-125989377 TCTGCCTGCACCTCCCGGGGTGG + Intergenic
1061169667 9:128945105-128945127 TCGCCCTGCAGCCTCGGAGGAGG - Intronic
1061217091 9:129227706-129227728 CCTCCCAGCACCCCCGGTGGAGG + Intergenic
1061942020 9:133888976-133888998 TGTCCCTGCCCCCCTGGCAGGGG - Intronic
1062353427 9:136150133-136150155 TCTCTCTGCAGCCCCGGGGCTGG + Intergenic
1062555796 9:137112922-137112944 TCTCCCTGCGCCCTGGGAGGCGG + Intronic
1186283121 X:8015820-8015842 TCTCCCTGCATCCCATCCGGTGG + Intergenic
1186480861 X:9895337-9895359 TCTCCCTGCACACAGGGCCGGGG - Exonic
1187464454 X:19515170-19515192 GCGCCCTCCACCCCCGGCGGCGG + Exonic
1187900746 X:24025319-24025341 CCTTCCTCCACCCCCGGCGTGGG - Intronic
1189298788 X:39937451-39937473 GCTCCCTGAGCCCCCAGCGGGGG + Intergenic
1190194963 X:48308986-48309008 TCCCCCTTCACCACCAGCGGAGG - Intergenic
1190661396 X:52657189-52657211 TCCCCCTTCACCACCAGCGGAGG - Intronic
1192174935 X:68879594-68879616 TCTGCCTGCACCCAGGGCAGAGG + Intergenic
1197753591 X:129980959-129980981 TCTACCTTCGCCCCCGGCCGAGG - Intergenic
1200119479 X:153783565-153783587 TCTCCCTGCCTCCCCGCCTGTGG - Intronic