ID: 1178454848

View in Genome Browser
Species Human (GRCh38)
Location 21:32739614-32739636
Sequence CCGCGCCCGGCCGTAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178454848_1178454859 20 Left 1178454848 21:32739614-32739636 CCTGTGGTTACGGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1178454859 21:32739657-32739679 AGCACTTTGGGAGGCTGAGGCGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
1178454848_1178454852 7 Left 1178454848 21:32739614-32739636 CCTGTGGTTACGGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1178454852 21:32739644-32739666 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1178454848_1178454860 21 Left 1178454848 21:32739614-32739636 CCTGTGGTTACGGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1178454860 21:32739658-32739680 GCACTTTGGGAGGCTGAGGCGGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1178454848_1178454857 17 Left 1178454848 21:32739614-32739636 CCTGTGGTTACGGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1178454857 21:32739654-32739676 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
1178454848_1178454853 8 Left 1178454848 21:32739614-32739636 CCTGTGGTTACGGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1178454853 21:32739645-32739667 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1178454848_1178454855 11 Left 1178454848 21:32739614-32739636 CCTGTGGTTACGGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1178454855 21:32739648-32739670 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178454848 Original CRISPR CCGCGCCCGGCCGTAACCAC AGG (reversed) Intronic
901048842 1:6416066-6416088 CTGCGCCCGGCCTTGCCCACTGG + Exonic
901076701 1:6559675-6559697 CCTCGCCCGGCCAAAACCTCAGG - Intronic
904291517 1:29488903-29488925 CCGTGTGGGGCCGTAACCACTGG + Intergenic
906364150 1:45191221-45191243 CCGCGCCCGGCCGAAATAGCTGG + Intronic
907185019 1:52602689-52602711 CCCCGCTCGGCCGTGACCTCTGG + Intronic
912682987 1:111740463-111740485 CCGCGCCCGGCCGGGACAGCCGG + Intronic
912798628 1:112707234-112707256 CCGCGCAGGGCCGCAGCCACCGG + Intronic
918390174 1:184051697-184051719 CCGCGCCCGGCCAGAAGCAGCGG - Exonic
919402703 1:197139304-197139326 CCGCGCCCGGCCAAAAACATGGG - Intronic
923152574 1:231246877-231246899 ACGCGCCCGGCCGAATCCAGTGG - Intronic
1062774708 10:135504-135526 CCGCGCCCGGCCCTCCCCTCCGG - Intronic
1069191304 10:65494631-65494653 CCGCGCCCGGCCCGGACCAGTGG + Intergenic
1072218426 10:93307588-93307610 CCACGCCCTGCAGTAACCACTGG + Intronic
1072611654 10:97021143-97021165 CCCCGCCCAGCGGTCACCACAGG + Intronic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1075340485 10:121643776-121643798 CCACGCCCGGCCGTCACCCGTGG + Intergenic
1075409912 10:122219745-122219767 CCACGCCCGGCCCCAACCTCAGG - Intronic
1076401688 10:130189431-130189453 CCGCGTCCGGCCGCAAATACTGG + Intergenic
1077034445 11:487999-488021 CCACGCCCGGCCCTGCCCACGGG - Intronic
1077034467 11:488068-488090 CCACGCCCGGCCCTGCCCACGGG - Intronic
1077880776 11:6347969-6347991 CCGCGCCTGGCCGCAGCTACTGG - Intergenic
1083306331 11:61763960-61763982 CCCCACCCTGCTGTAACCACGGG - Intronic
1083584784 11:63848849-63848871 CCGTGCCCGGCTGTAACACCTGG + Intronic
1084329190 11:68420411-68420433 CCGCGCCCAGCCTTTACAACGGG - Intronic
1091718121 12:2794524-2794546 CCGGGACCGGCCGTCACCACGGG - Intergenic
1092533525 12:9364959-9364981 CCACACCCGGCTGTAGCCACTGG + Intergenic
1094367134 12:29695593-29695615 CCGCGCCAGGCCACATCCACAGG + Intronic
1101941477 12:109102320-109102342 CCGCGCCCGGCCCAAAGCAGTGG - Intronic
1103071879 12:117951196-117951218 CCGCGCCCGGCGGCAACCAGTGG + Intronic
1104049615 12:125186697-125186719 CGGCGCCCGGGCGTAGCCGCCGG + Intergenic
1110444229 13:75559328-75559350 CCGCGCCCGGCCCTCAGCCCCGG + Intronic
1119144158 14:72294999-72295021 CCGCGCCCGGCCTGAACAAAGGG - Intronic
1121279326 14:92687885-92687907 CAGGGCCCCGCCGTGACCACAGG + Intronic
1121342885 14:93115691-93115713 CCCAGCCGGGCCGTAACCCCTGG + Intronic
1121757123 14:96412516-96412538 CTGCGCCCGGCCGTGACTCCTGG + Intronic
1122582222 14:102777823-102777845 CCGCGCCCCGCCGTCGCCGCTGG - Intronic
1132482393 16:173040-173062 CCTCGCCCGCCCGGACCCACAGG + Intronic
1132483241 16:176844-176866 CCTCGCCCGCCCGGACCCACAGG + Intronic
1133008014 16:2895334-2895356 CCGCGCCTGGCCACACCCACTGG - Intronic
1146356741 17:32140886-32140908 CCGCGCCCAGCCTAATCCACAGG - Intergenic
1147653103 17:42072966-42072988 CCGCCCCCGGCCGCTACCTCTGG + Intergenic
1149828156 17:59848436-59848458 CCGCGCCCGGCCCTGATCACAGG + Intergenic
1152260649 17:79265079-79265101 CCACGCTCGGCAGTGACCACAGG + Intronic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1159511286 18:69400912-69400934 CCGCCCCCGGCAGCACCCACGGG - Intergenic
1160195181 18:76748308-76748330 CCGCGCCCGGCCTCAACAACAGG - Intergenic
1160736652 19:665750-665772 CCGCGCCCGGCCCTTTCCCCTGG + Intergenic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1161752289 19:6107003-6107025 CCGCGCCCGGCCGGCACCTGTGG - Intronic
1165931408 19:39361631-39361653 CCGCGCCCGGCCGGGAAGACAGG - Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
932804799 2:74774237-74774259 CCGCGCCCGGCCTTAAACACTGG - Intergenic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
944549073 2:200829042-200829064 CCGCGCCCAGCCATAAATACAGG + Intergenic
945869022 2:215206874-215206896 CTGTGCCCGGCCAGAACCACTGG + Intergenic
1175831057 20:61965745-61965767 CCGCCCCGGGCCTTACCCACGGG + Intronic
1178454848 21:32739614-32739636 CCGCGCCCGGCCGTAACCACAGG - Intronic
1182856056 22:33518597-33518619 CCGCGCCCGGCCTCAGGCACAGG + Intronic
1184881376 22:47306524-47306546 CCGCGCCCGGCCAGAACCCCCGG - Intergenic
950837656 3:15936104-15936126 CCGCGCCCGGCCTAATCCTCAGG + Intergenic
953320637 3:41968125-41968147 CCGCGCCCGGCCTTAAAAAAAGG - Intergenic
960341852 3:116484943-116484965 CTGTGCCCGGCCTTAACCTCTGG - Intronic
961386101 3:126524281-126524303 CCGCCCCCAGCCGTATCCAGCGG + Exonic
961705446 3:128781724-128781746 CCGTGCCCGGCCACAACCATGGG - Intronic
962816008 3:139000956-139000978 CCGCGCCTGGCCGTCTCCTCTGG + Intergenic
965346957 3:167563074-167563096 CCGCGCCCGGCCCTAAAATCAGG - Intronic
967194378 3:187013873-187013895 CCGCACCCGGCCGCAAATACTGG + Intronic
994076283 5:95653606-95653628 CTGCGCCCGGCCATAAATACTGG - Intronic
1005719509 6:28587301-28587323 CCGGGCCCGGCCGGAACCTACGG - Exonic
1006859903 6:37164674-37164696 CCGCGCCCGGCCGAAAATGCTGG - Intergenic
1008545179 6:52577280-52577302 CCGCGCCCGGCCGCATTCTCGGG + Intergenic
1013013015 6:106136532-106136554 CCGCACCCGGCCTGACCCACAGG - Intergenic
1019605892 7:1910089-1910111 CCGCGCCCGCCTGTCACCCCAGG - Intronic
1042093211 8:65181509-65181531 CCGCGCCCGGCCTCCATCACTGG + Intergenic
1046732539 8:117740818-117740840 CCGCGCCCGGCCAGGAGCACTGG - Intergenic
1047288697 8:123510319-123510341 CCGCGCCCGGCCCCAACTGCAGG - Intronic
1048921213 8:139231679-139231701 CTGCGCCCAGCCGAAACAACTGG + Intergenic
1057041471 9:91851060-91851082 CCGCGCCCGGCCGGAATCTATGG - Intronic
1061472101 9:130835159-130835181 CCGCGCCCGTCCGCACCCAGGGG - Intronic
1062412943 9:136433945-136433967 CCGTGCCCAGCCATGACCACAGG + Intronic
1200086641 X:153610329-153610351 CCGCCCCCCGCCGCAACCCCGGG - Intergenic
1200292167 X:154885081-154885103 CCGCCCCCGGCCGCCAGCACCGG - Exonic
1200303957 X:155006554-155006576 CCGCGCCCAACAGGAACCACAGG + Intronic
1200317429 X:155148352-155148374 CCGCGCCCAACAGGAACCACAGG - Intergenic
1200339005 X:155380818-155380840 CCGCCCCCGGCCGCCAGCACCGG - Exonic
1200347464 X:155459874-155459896 CCGCCCCCGGCCGCCAGCACCGG + Exonic