ID: 1178455691

View in Genome Browser
Species Human (GRCh38)
Location 21:32748139-32748161
Sequence ATGGGAAAGCACAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178455691_1178455696 -2 Left 1178455691 21:32748139-32748161 CCTGCCTCATTGTGCTTTCCCAT 0: 1
1: 0
2: 2
3: 28
4: 271
Right 1178455696 21:32748160-32748182 ATCTGGTTCTGAGTTCCTCTAGG 0: 1
1: 0
2: 3
3: 23
4: 249
1178455691_1178455697 6 Left 1178455691 21:32748139-32748161 CCTGCCTCATTGTGCTTTCCCAT 0: 1
1: 0
2: 2
3: 28
4: 271
Right 1178455697 21:32748168-32748190 CTGAGTTCCTCTAGGATCAAAGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178455691 Original CRISPR ATGGGAAAGCACAATGAGGC AGG (reversed) Intronic
900798507 1:4723854-4723876 ATGGAAATGGACAATGTGGCAGG + Intronic
901147573 1:7076708-7076730 TTGGGAAAGCAGAATGGGACTGG - Intronic
901192635 1:7421754-7421776 AAGGGAAAGACCAAGGAGGCAGG + Intronic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
902602906 1:17552092-17552114 ATGGGAAAACTCCATGGGGCTGG + Intronic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904949657 1:34226238-34226260 AGGAGAAGGCACATTGAGGCTGG + Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
906273004 1:44496249-44496271 ATGGGAAATCCCAGTGAAGCTGG + Intronic
907174494 1:52505808-52505830 ATGGTAAATCACAATGAGCGGGG + Intronic
907794153 1:57697945-57697967 AGAGGAAAGCACAAGGAGGATGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908109762 1:60885044-60885066 AAGGTATAGCACAATGAGGGTGG - Intronic
913434613 1:118833739-118833761 AATGGAAAACACAAAGAGGCAGG + Intergenic
913494118 1:119412062-119412084 AAGTGAAAGCACAATGATGTGGG + Intergenic
914398884 1:147297267-147297289 CTGGGAAAGTAGAATGAGACAGG + Intergenic
915640195 1:157218850-157218872 TTGGGAAGGCACAATGTGACAGG + Intergenic
915953033 1:160202767-160202789 TTGGGTAAGCATAATGGGGCTGG + Intergenic
916269585 1:162926297-162926319 ATGGGAGAGCACAAGAAAGCTGG + Intergenic
917177005 1:172246430-172246452 ATGGGAAAAGACAAGAAGGCTGG + Intronic
918662777 1:187109504-187109526 ATGGGAAAGCATAAGGAGATAGG - Intergenic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
921658090 1:217764662-217764684 ATGGGAATGCAAAATGATACAGG - Intronic
922276628 1:224085075-224085097 ATGGGATATCACTCTGAGGCTGG - Intergenic
922849323 1:228719179-228719201 ATAGGAAAGCAAAATGATACAGG - Intergenic
923834468 1:237594694-237594716 AAGGGAAAGAACAAAAAGGCTGG - Intronic
1062792455 10:317391-317413 TGCGGAAAGCACCATGAGGCTGG + Intronic
1063293019 10:4770839-4770861 ATGTGAGAGCACAATGAGTCAGG - Intergenic
1063506031 10:6600442-6600464 ATGGGAAAGCACATTGTGTCAGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066574312 10:36808967-36808989 TTGGAAAAGGGCAATGAGGCAGG - Intergenic
1068360948 10:55974485-55974507 AAGTGAAAGCACAGAGAGGCTGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070779512 10:79129497-79129519 ATGGGCAGGCACAATCTGGCTGG - Intronic
1073235003 10:102006868-102006890 ATTAGAAAGCTCACTGAGGCTGG + Intronic
1073932676 10:108594246-108594268 ATGTGGAAGCATAATGAAGCAGG - Intergenic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1077598901 11:3558839-3558861 AGTACAAAGCACAATGAGGCTGG + Intergenic
1078665130 11:13318116-13318138 ATGGAAAGGTACAGTGAGGCTGG - Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1080684067 11:34501156-34501178 ACGGTAGAGCACAGTGAGGCTGG - Intronic
1082790071 11:57340982-57341004 ATGGGAACACACACAGAGGCCGG + Intronic
1083601411 11:63950756-63950778 ATATGAAAACACTATGAGGCCGG - Intronic
1084254978 11:67934735-67934757 AGTACAAAGCACAATGAGGCTGG + Intergenic
1084457226 11:69274891-69274913 ATGGGAAAGCAGCATTAGGGAGG + Intergenic
1084817907 11:71661181-71661203 AGTACAAAGCACAATGAGGCTGG - Intergenic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1086005813 11:82034181-82034203 ATGAGAAAACACACTCAGGCAGG + Intergenic
1086223323 11:84476828-84476850 GTGGGAAGACACAAAGAGGCTGG - Intronic
1087302531 11:96452548-96452570 AGTGGTAAGCACAGTGAGGCAGG - Intronic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1088929965 11:114341508-114341530 ATGGGAAAGGAAGATGATGCAGG - Intergenic
1089285234 11:117402992-117403014 AATGGAAAGCAAAAAGAGGCAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090275907 11:125419342-125419364 ATGGGAACTCTCAATGAGACTGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1091938356 12:4451330-4451352 ATGCGAAATATCAATGAGGCAGG - Intergenic
1092386795 12:8041803-8041825 AAGGGAAAGCTCAATGGGCCAGG - Intronic
1092425038 12:8368179-8368201 AGTAGAAAGCACAATGAGGCTGG + Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093024519 12:14233861-14233883 ATGTGAAAGCAAAAAGAGGTTGG - Intergenic
1094851657 12:34385009-34385031 AGGGGCCAGCACAAGGAGGCAGG - Intergenic
1095300387 12:40577889-40577911 ATTGGAAAACAAAATGAGTCTGG - Intergenic
1095395889 12:41761909-41761931 ACAGGAAAGCATAAAGAGGCCGG - Intergenic
1096166932 12:49433859-49433881 AGGGGAAAGCTTCATGAGGCAGG - Intronic
1096741826 12:53699105-53699127 ATGGGAAAGCACAATTAGTCGGG - Intergenic
1097183395 12:57183732-57183754 ATGGGGATGCCCAATAAGGCAGG - Intronic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1097808347 12:63990088-63990110 ATTGGAAAGCACACTATGGCAGG - Intronic
1098870811 12:75815040-75815062 ATGGAAAGGCACAGTGAGGCAGG - Intergenic
1099827572 12:87797780-87797802 ATTGGCAAGAACAATCAGGCTGG + Intergenic
1100307450 12:93364021-93364043 AGGGGAAAAAAAAATGAGGCAGG - Intergenic
1100617444 12:96241961-96241983 ATGGGAAATTACAAAGAGACTGG + Intronic
1101265325 12:103078977-103078999 ATGAGAAAGCACACTGGAGCTGG - Intergenic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105624153 13:22096950-22096972 ATGGGAAAGGACACTGGGGTTGG - Intergenic
1105852092 13:24344145-24344167 ATTGGAAAACAAAAAGAGGCAGG + Intergenic
1106583104 13:31034385-31034407 ATGGGGATGCACACTGGGGCCGG - Intergenic
1106930190 13:34654896-34654918 ATGAGAGAGCACAATGTGGCTGG - Intergenic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110901400 13:80830355-80830377 AAGGGAGAGCACAATGATGGTGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111242267 13:85490606-85490628 CCAGGAAAGCCCAATGAGGCTGG + Intergenic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1112574977 13:100627470-100627492 ATGGGCAAGCACCGTGAGACAGG - Intronic
1113017457 13:105843802-105843824 ATTGGATAGAACAAGGAGGCGGG + Intergenic
1113485188 13:110647678-110647700 ATGGGACAGCCCAAAGAGGGAGG + Intronic
1113558210 13:111255386-111255408 ATGGGCAAGCAACATGAGGCAGG - Intronic
1114527924 14:23377969-23377991 TGGGGAAAGCATTATGAGGCAGG + Intronic
1117081606 14:52157588-52157610 ATAGGAAATAAAAATGAGGCTGG - Intergenic
1117116568 14:52519693-52519715 ATGGTAGAGCAAAATGAGGTTGG - Intronic
1117160456 14:52984444-52984466 ATGGGAAAGGATCTTGAGGCTGG + Intergenic
1117426430 14:55603132-55603154 AAGGGAAAGAACAATGATGCAGG - Intronic
1119387033 14:74263914-74263936 ATGGGAAAGAGCCATGAGCCTGG + Intergenic
1124920632 15:34022889-34022911 ATAGAAAAGAACAATGAGGCCGG + Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126407549 15:48336917-48336939 AGTGGAAAGAACAAGGAGGCTGG - Intronic
1128346819 15:66859019-66859041 ACGGGAATGCAAAATGATGCAGG - Intergenic
1128592127 15:68908615-68908637 CAGGGAAAGCCCAGTGAGGCTGG + Intronic
1129102840 15:73282105-73282127 AAGGGAAAGGACCCTGAGGCAGG - Intronic
1129922603 15:79332713-79332735 ATGGGAAATCACAACCAGGTAGG - Intronic
1130520774 15:84659004-84659026 ATGGGAATGCAGAATGATGGAGG + Intergenic
1130897428 15:88182261-88182283 TTGGGAAAACACAAAGAGCCTGG + Intronic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133373205 16:5261848-5261870 ACTACAAAGCACAATGAGGCTGG - Intergenic
1134647343 16:15880291-15880313 GTGGGAAAGCACAATGGTACAGG + Intronic
1134861161 16:17561693-17561715 AAGGTAAAAGACAATGAGGCAGG - Intergenic
1134878134 16:17720418-17720440 ATGGGAAAACACACTCAGGGAGG + Intergenic
1135308788 16:21389365-21389387 ATGGTAAAGGAAAATGGGGCCGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136305531 16:29368496-29368518 ATGGTAAAGGAAAATGGGGCCGG + Intergenic
1137386944 16:48050617-48050639 ATGAGAAAGCACAATGGGTAGGG + Intergenic
1138793296 16:59935283-59935305 ATGGGAATGCAAAATGGTGCAGG - Intergenic
1138927246 16:61607579-61607601 ATGGCATAGCACAATGAGCATGG + Intergenic
1141414405 16:83859013-83859035 AGGGGAAAGCAGAGTGAGTCAGG + Intergenic
1141453423 16:84121036-84121058 ATGGGAACACACAGTGGGGCAGG - Intergenic
1141619339 16:85228514-85228536 ATAGGAAAGCACACTAGGGCTGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142701225 17:1662290-1662312 AAAGCAAAACACAATGAGGCTGG + Intronic
1147361436 17:39933280-39933302 AGATGAAAGCACACTGAGGCTGG - Intergenic
1147422551 17:40329748-40329770 AATCAAAAGCACAATGAGGCTGG - Intronic
1148201294 17:45751691-45751713 ATGCCACAGAACAATGAGGCTGG - Intergenic
1150165423 17:62936735-62936757 AAGAGAAAGCTCCATGAGGCAGG + Intergenic
1150608333 17:66713344-66713366 TTTAGAAAGCACAATGAGGTCGG - Intronic
1151796119 17:76347053-76347075 AGGAGAAAGAACAATGGGGCTGG + Intronic
1153586577 18:6627198-6627220 ATGGTAAAGAACAATGACCCAGG - Intergenic
1153646275 18:7198925-7198947 ATGGAAAAGCCCAATATGGCTGG - Intergenic
1154281902 18:13010928-13010950 ATTCAAAACCACAATGAGGCTGG + Intronic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1159439328 18:68456970-68456992 ATGTGAAATCACACTGAGCCTGG + Intergenic
1159619151 18:70617800-70617822 ATCAGAAAGCACAAAAAGGCAGG - Intergenic
1160373156 18:78390980-78391002 CGGGGAAAGCACGGTGAGGCCGG - Intergenic
1161335062 19:3708570-3708592 GTGGAAAAGCACAGTGGGGCGGG - Intronic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162274025 19:9638977-9638999 ATGTGAAAGCAAAAAGAGGTCGG + Intronic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1164258935 19:23552536-23552558 AAGAGAAAGCAAAAAGAGGCTGG - Intronic
1165087826 19:33363641-33363663 ATGGCATATCAGAATGAGGCGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168180560 19:54660148-54660170 ATACAAAAGCAAAATGAGGCCGG + Intronic
925859861 2:8163728-8163750 ATGGAAAAGCACCATGGGCCTGG - Intergenic
926258899 2:11238169-11238191 ATAGGAAAGCATGATAAGGCTGG + Intronic
928835659 2:35541543-35541565 ATAGGAAGGCACAATGTTGCAGG + Intergenic
930868657 2:56147975-56147997 ATGAGAAAGACCAGTGAGGCTGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
937134433 2:119540674-119540696 GTGGGGAAACACAATGAAGCAGG + Intergenic
937192157 2:120112884-120112906 AAGGCACAGAACAATGAGGCTGG + Intronic
937709955 2:124969233-124969255 AGGGGAGAGCAAAAAGAGGCAGG + Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938179706 2:129169382-129169404 TTGGGACAGCACAAAGGGGCAGG - Intergenic
938671228 2:133588514-133588536 ATGGGAAAAGGAAATGAGGCAGG - Intergenic
939397353 2:141648172-141648194 TTGGGATAGTACAAAGAGGCTGG + Intronic
939620694 2:144415419-144415441 ATGGGAAAGCAAAATGAACCGGG - Intronic
940217004 2:151312127-151312149 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
940911906 2:159216639-159216661 AGGAGAAAGGACAACGAGGCGGG - Intronic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
942525231 2:176846016-176846038 ATGGGAAAGCACCAAAAGCCAGG + Intergenic
945143808 2:206715294-206715316 AAGGCAAAGCCCAAGGAGGCTGG - Intronic
947039152 2:225895493-225895515 ATTGGAAATCACCAGGAGGCAGG - Intergenic
948573959 2:238937868-238937890 AGGTGAAAGTACAATGAGCCAGG - Intergenic
1169448591 20:5692371-5692393 TTGTGACAGCACAATGAGGCAGG - Intergenic
1170685597 20:18566978-18567000 AGGGGAAAGGCCACTGAGGCTGG + Intergenic
1170929730 20:20758162-20758184 ATGGGAAAGCAGAAAGGGACAGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1173066067 20:39713275-39713297 ATGGCAAGGCAGAAAGAGGCAGG + Intergenic
1173102084 20:40096617-40096639 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
1173374439 20:42470800-42470822 ATGGGTAAGGACAGAGAGGCAGG + Intronic
1175260688 20:57672445-57672467 ATCAGGAAGCACAATGCGGCTGG + Intronic
1177080269 21:16631037-16631059 ATGGGAATGCAGAATGTGTCAGG + Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178599376 21:33982963-33982985 GTGGGAATGCAAAATGATGCAGG - Intergenic
1179452923 21:41477951-41477973 TTGGGAACTCACAAGGAGGCTGG - Intronic
1179487715 21:41721648-41721670 AAGGGAAAGCAAAAGGCGGCAGG - Intergenic
1180139928 21:45887003-45887025 AAGGGACAGCACAGTGAGGCTGG - Intronic
1181030321 22:20146301-20146323 GTGGGAAAGCACACTGGGGAGGG + Intronic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
950050858 3:9987936-9987958 ATGGCAAAACACAATGCTGCAGG - Intronic
950156241 3:10723624-10723646 ATGGGAAAGCACTGGGAGGGTGG + Intergenic
950363532 3:12466789-12466811 ATGGGAATGCACAATGGTACAGG + Intergenic
950751562 3:15133014-15133036 AGTACAAAGCACAATGAGGCTGG - Intergenic
951178562 3:19631343-19631365 ATGGAAAATCACAATGAGATAGG - Intergenic
951403648 3:22266548-22266570 ATGAGAAAGCACAATTAGAAAGG + Intronic
953637313 3:44674120-44674142 AAGAGAAAGCACAAAGAAGCAGG - Intergenic
955449072 3:59048506-59048528 ATGGGAAAGCAAAAAGCAGCAGG - Intronic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
959558109 3:107746749-107746771 ATGGGAAAGAATCAGGAGGCTGG - Intronic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961029507 3:123589575-123589597 ATGGGAAAGTAGGAGGAGGCAGG + Intergenic
962041297 3:131710007-131710029 ATAGGTAAGCTCCATGAGGCAGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962961127 3:140312038-140312060 AAGGGAAAGCACTCTGAGTCTGG - Intronic
964855378 3:161140553-161140575 TTGGTAAAGCACAAGGATGCTGG + Intronic
966705918 3:182913379-182913401 CTGGGAAATAACAATCAGGCAGG - Intronic
968424728 4:515452-515474 AGGGGAGCGCAGAATGAGGCAGG - Intronic
969013386 4:4085830-4085852 AGTAAAAAGCACAATGAGGCTGG + Intergenic
969799813 4:9554800-9554822 AGTACAAAGCACAATGAGGCTGG - Intergenic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
970522932 4:16903670-16903692 ACGGGCAAGCACAAAGAGGCTGG - Intergenic
972609999 4:40647566-40647588 GTAGAAAACCACAATGAGGCTGG - Intergenic
973051213 4:45600307-45600329 ATGGGAATGTACAATGATGCAGG + Intergenic
973321056 4:48810698-48810720 CTAGGTAAGCACCATGAGGCAGG - Intronic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
979667317 4:123326493-123326515 AAGGGAAAGCACAGTAAGGCTGG - Intergenic
983474218 4:168195143-168195165 ATCCCAAAGCACAAAGAGGCTGG + Intergenic
983830661 4:172322692-172322714 ATGGGATAGCACTAGGAGGATGG + Intronic
985531029 5:433950-433972 GCGGGAAAGCACAGTGAGGATGG + Exonic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
988274169 5:29058986-29059008 ATAGGTAAGCTCATTGAGGCTGG + Intergenic
988636183 5:32987165-32987187 TTTAGAAAGCAAAATGAGGCCGG - Intergenic
988721727 5:33885806-33885828 ATAGGAAAGCAAAATGAGTTTGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
992829045 5:80576684-80576706 ATGGGAAAGTAAAATGGTGCAGG + Intergenic
992976973 5:82130605-82130627 ATTGGAAAGCACAAGGGGTCGGG - Intronic
994414525 5:99451654-99451676 AGGGGGTAGCACAAGGAGGCGGG - Intergenic
995477445 5:112562449-112562471 ATGGGACAGCACTAGGAGGATGG - Intergenic
995860743 5:116637822-116637844 ATGAGAAAGCCCCATGAGTCTGG + Intergenic
996163327 5:120194612-120194634 AATGGAAAGCAAAATAAGGCAGG + Intergenic
997800363 5:136854626-136854648 GTTTGAAAGCAAAATGAGGCTGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
1000475706 5:161704310-161704332 CTGGGAGGACACAATGAGGCTGG + Intergenic
1001253000 5:170162800-170162822 ATGAGAAGGCACCATGAGCCAGG + Intergenic
1002954264 6:1846534-1846556 ATGGGAAAACTCTAAGAGGCTGG + Intronic
1003094405 6:3131289-3131311 ATGGGAAAGAACAAGTGGGCAGG - Intronic
1004631721 6:17427557-17427579 ATGGGAATGTAAAATGATGCAGG + Intronic
1005235158 6:23752679-23752701 ATGGAAAAAGACAATGAGCCTGG - Intergenic
1005432896 6:25777028-25777050 ATGTGAAAGTAAAATGTGGCAGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1010188149 6:73166134-73166156 ATGGTAAAACACACTCAGGCCGG + Intronic
1011167551 6:84466215-84466237 ATGGCAAAGCAAAAAGAGCCAGG - Intergenic
1012326769 6:97929258-97929280 CAGGGAGAGCACAATGAGTCAGG - Intergenic
1013383574 6:109601899-109601921 ATTGGAAAGCAAAAAAAGGCAGG - Intronic
1016000075 6:139033008-139033030 ATGGGAACACACAGTGAGGGAGG + Intronic
1016445815 6:144131095-144131117 ATCAGAAGGCACAATGAGGCTGG - Intergenic
1016474256 6:144409479-144409501 ATGGGAAAGCACAAGGAAGGTGG - Intronic
1017295159 6:152785288-152785310 AGGAGAAAGCAGAATAAGGCAGG - Intergenic
1017559977 6:155616105-155616127 ATGGGCTACCACAATGATGCAGG + Intergenic
1017644323 6:156525102-156525124 ATGAGAAAGCAGAATCAGGGAGG - Intergenic
1017747435 6:157459633-157459655 ATGGGTAAGCTCAGTGAGCCTGG + Intronic
1018027193 6:159815775-159815797 AGGGGAAAGAACAATGGTGCAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1019776937 7:2917432-2917454 AGGGGAGAACACAATGATGCTGG + Intronic
1020101105 7:5394806-5394828 TTGAGAAAGCACAATACGGCAGG + Intronic
1021973996 7:25993924-25993946 ATGGGAAAGAACAGAGAGTCTGG + Intergenic
1022783407 7:33610239-33610261 ATGGGATAGCACTATGAGTGTGG + Intergenic
1024244332 7:47457764-47457786 ATGGGAAAGGACTTGGAGGCAGG + Intronic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028507104 7:91582752-91582774 ATGGTAAAGTACACGGAGGCAGG + Intergenic
1029072031 7:97907466-97907488 AGTACAAAGCACAATGAGGCTGG + Intergenic
1029498876 7:100915278-100915300 TTGGGAAAACACCATGAGTCAGG - Intergenic
1030709068 7:112728644-112728666 ATGGGAAGGCACAATTACCCAGG - Intergenic
1031445962 7:121854515-121854537 ATTGCAAAGTACAATGAGCCAGG - Intergenic
1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG + Intronic
1033435439 7:141329382-141329404 ATGGGAAAGAATAATGAGAATGG - Intronic
1033469459 7:141631852-141631874 ATGAGAAATCCAAATGAGGCCGG - Intronic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1034998775 7:155594977-155594999 AAGGGAAATCACACAGAGGCAGG + Intergenic
1036255128 8:7199933-7199955 AGTACAAAGCACAATGAGGCTGG + Intergenic
1036362361 8:8087574-8087596 AGTACAAAGCACAATGAGGCTGG - Intergenic
1037394155 8:18424362-18424384 ATGGGACAGGAAAATGAGGTGGG + Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038559666 8:28561948-28561970 ATGGCAAAGCTCAGTGAGTCAGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038639194 8:29310314-29310336 ATGCGAAAACACAAAGAGGTGGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039151427 8:34510955-34510977 ATGACACAGCACAATGAGACTGG + Intergenic
1039592729 8:38763451-38763473 ATGCTAAAACAAAATGAGGCCGG - Intronic
1040484886 8:47860493-47860515 ATGGGAACCCACAGTGAGGCTGG + Intronic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048196505 8:132336130-132336152 ATGGGAATGCACAGTCAGGTGGG - Intronic
1048855638 8:138684701-138684723 ATGGGAAAGCAAACTGAGAGAGG - Intronic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1056940783 9:90954283-90954305 ATGGGAGAGTCCATTGAGGCTGG + Intergenic
1061633216 9:131887252-131887274 TTGAGAATCCACAATGAGGCTGG - Intronic
1062028401 9:134350998-134351020 ATAGGAAAGGACACTTAGGCAGG - Intronic
1186332163 X:8546057-8546079 ATGGGAAAGGACACTTTGGCTGG - Intronic
1188800813 X:34527505-34527527 ATTGGTAGGCACAGTGAGGCAGG - Intergenic
1189443769 X:41061590-41061612 ATCAAAAAGCATAATGAGGCCGG + Intergenic
1191096284 X:56675987-56676009 AATGGAAAGCAAAATGAAGCAGG + Intergenic
1193478203 X:81993793-81993815 ATGGCATAGCATAATTAGGCAGG + Intergenic
1194954179 X:100160407-100160429 ATGGGAAAGCAGAAAAGGGCAGG - Intergenic
1195033254 X:100947146-100947168 ATGGGAAAGCTAAATTAGGTTGG - Intergenic
1196685170 X:118504498-118504520 AGGAGAAAGCACAATCAGACAGG - Intronic
1197645343 X:129011051-129011073 AAAGGAAAGCACGATAAGGCAGG + Intergenic
1198381022 X:136083393-136083415 GTGGGAAAGAACAATGTGACAGG + Intergenic
1198397749 X:136238609-136238631 TTGGGAAAGCACATTGAGGGTGG + Intronic
1199482309 X:148311180-148311202 ATGGGAAAGCAGAAAGCCGCAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic