ID: 1178460124

View in Genome Browser
Species Human (GRCh38)
Location 21:32795474-32795496
Sequence TAACATTCCCCCAATGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178460123_1178460124 2 Left 1178460123 21:32795449-32795471 CCACATTTCAGTTTGGCGAAAGT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1178460124 21:32795474-32795496 TAACATTCCCCCAATGACTGAGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178460124 Original CRISPR TAACATTCCCCCAATGACTG AGG Intronic
901428917 1:9200554-9200576 CAAATTTCCCCAAATGACTGAGG + Intergenic
904602680 1:31682533-31682555 TCACATGTCCCTAATGACTGGGG + Intronic
904897384 1:33827105-33827127 TACCTTTCCCCTCATGACTGTGG + Intronic
907675709 1:56516016-56516038 TGACATTTACTCAATGACTGTGG + Intronic
908000043 1:59670913-59670935 TAAGTTTCCCCCACTGACTTGGG + Intronic
908325684 1:63021259-63021281 TAACATTCCCACATGGACTAAGG - Intergenic
908963221 1:69727131-69727153 ATACATCCCTCCAATGACTGAGG - Intronic
912864237 1:113242851-113242873 GCTCATTCACCCAATGACTGTGG - Intergenic
916246407 1:162692569-162692591 TCACATTTCCCTAGTGACTGAGG - Intronic
923476709 1:234340474-234340496 TTTCATTTCCCTAATGACTGAGG - Intergenic
923936397 1:238765118-238765140 TATCTTTCCCCCATTGGCTGGGG + Intergenic
1069212256 10:65776998-65777020 TTACATTTCCCTAATGACTAAGG + Intergenic
1071746450 10:88425090-88425112 TAACATGCTGCCAATGGCTGTGG - Intronic
1071934908 10:90518357-90518379 TAACCTTCTCCCAATGAGTTTGG - Intergenic
1074305097 10:112269623-112269645 TAACAATTGCCCATTGACTGGGG - Intergenic
1079520635 11:21322252-21322274 TTACATTCCCCAAATGACAAGGG - Intronic
1079881270 11:25930067-25930089 GCAAATTCTCCCAATGACTGTGG - Intergenic
1081056178 11:38413282-38413304 TAATTTTCTCCCAATGCCTGGGG - Intergenic
1085306221 11:75487484-75487506 TAACATTTCCCCAGAGAATGAGG - Intronic
1088421195 11:109649144-109649166 TAACCATCCCCCAATGCCTGTGG + Intergenic
1094610016 12:31986255-31986277 TGACATTCCCACAAGGAATGTGG - Intronic
1094826934 12:34276596-34276618 TAGGATGCCCCGAATGACTGTGG + Intergenic
1097515357 12:60597626-60597648 AAACTTTCCCCAAATTACTGAGG + Intergenic
1097994896 12:65877483-65877505 TTACATTCTCCCAGTGACCGGGG - Intronic
1102903912 12:116660384-116660406 TATCATTTCCCCAATCACTTAGG + Intergenic
1105669370 13:22594940-22594962 AAATATTCCTTCAATGACTGAGG + Intergenic
1108177680 13:47810125-47810147 GAAAAATCCCCCAATGCCTGGGG - Intergenic
1116303882 14:43223038-43223060 TAATAATCCCCAAATGTCTGTGG - Intergenic
1118368549 14:65116156-65116178 AAACCTACCCCCAAAGACTGAGG - Intergenic
1118576369 14:67245371-67245393 TTGCATTTCCCCCATGACTGAGG + Intronic
1123826834 15:24090937-24090959 TTACATTTCCCTAATGACAGAGG + Intergenic
1125964626 15:43864015-43864037 TAATATTCCCCATATGAGTGAGG + Intronic
1130094458 15:80845701-80845723 TAACCTTCCCACAGTGACTTTGG + Intronic
1130379877 15:83362422-83362444 TAATATTCCCCCAATGCATGAGG - Intergenic
1133207929 16:4245077-4245099 TGACATTCCTCAGATGACTGGGG + Intergenic
1135053026 16:19207649-19207671 TAACTTTCCCCCAATGTTGGAGG - Intronic
1140074708 16:71687150-71687172 TTGCATTTCCCTAATGACTGAGG + Intronic
1140436843 16:74954088-74954110 TTATATTCCCCCAGTGACTAAGG - Intronic
1141397623 16:83718885-83718907 CAACCCTCACCCAATGACTGGGG - Intronic
1147530390 17:41271141-41271163 TGACAATACCACAATGACTGTGG + Intergenic
1148510714 17:48167210-48167232 TGCCAAGCCCCCAATGACTGTGG + Intronic
1150893281 17:69179571-69179593 TAACATTCCCCAAAACACTGGGG + Intronic
1152299401 17:79486274-79486296 TACCATTCCCCCACTTCCTGGGG + Intronic
1156911110 18:42412031-42412053 TACCCTTCCCCCAATGGATGTGG - Intergenic
1157330459 18:46700384-46700406 TAACCTTTTCCCAAAGACTGAGG + Intronic
1159839106 18:73375396-73375418 TAACAGTTCCCCAATGGCTGGGG + Intergenic
1160181257 18:76638582-76638604 GAAGATGCCCCCAATAACTGGGG - Intergenic
1166635791 19:44450989-44451011 TTCCATTTCCCTAATGACTGAGG - Intergenic
935367682 2:102312136-102312158 AAACATTCACTCAATGACAGAGG + Intronic
935870802 2:107446912-107446934 TAACATTCACCAAAAAACTGAGG + Intergenic
942497311 2:176553435-176553457 TAACTTGCCTCCAATGATTGTGG + Intergenic
944031365 2:195238633-195238655 TAACATTCCACAAATGACTTAGG - Intergenic
945019260 2:205554953-205554975 AACCATTCCCCCAAGGAATGGGG + Intronic
945706523 2:213240905-213240927 TAATTTTCCCCTAATAACTGAGG + Intergenic
948317808 2:237042623-237042645 TAACATTCCCACAATTTATGAGG + Intergenic
948389455 2:237601609-237601631 TCACCTTCCCCGACTGACTGAGG + Intronic
1168749439 20:271782-271804 AATCTTTCCACCAATGACTGAGG - Intronic
1171190448 20:23155391-23155413 TGTCTTTCCCCCATTGACTGGGG - Intergenic
1171866728 20:30491281-30491303 TCAGATGCCCCGAATGACTGTGG - Intergenic
1172768613 20:37364069-37364091 TAACAGTACCCCAATGGCAGGGG - Intronic
1175664985 20:60851019-60851041 TGATCTTTCCCCAATGACTGGGG + Intergenic
1178460124 21:32795474-32795496 TAACATTCCCCCAATGACTGAGG + Intronic
1182552041 22:31105849-31105871 CAACATGGTCCCAATGACTGGGG - Intronic
951686366 3:25349114-25349136 TACCCTTCCCCCAATGAAGGCGG + Intronic
952189625 3:31008965-31008987 TCACATTCCCACAGTGAGTGAGG - Intergenic
952367420 3:32687025-32687047 AAACAGTCCCCTAATCACTGTGG - Intronic
952706395 3:36381591-36381613 TCACATTCCCCAAATGCCTGGGG - Intronic
953175804 3:40551021-40551043 TAAAAATCCCACAATGACTAAGG - Intronic
955923612 3:63984041-63984063 TAACATGCCTCCACTGGCTGGGG - Intronic
959668683 3:108949590-108949612 TTACATTCCCCAAAGGTCTGAGG + Intronic
961085167 3:124060887-124060909 AACCATTCCCCCAACCACTGGGG - Intergenic
962066172 3:131982615-131982637 TAATATACCACCAATGACTCTGG - Intronic
963465839 3:145680974-145680996 TATAATTTCCCCAAGGACTGAGG - Intergenic
964419496 3:156486499-156486521 AAACATTACCCCCATGACTGGGG + Intronic
968083093 3:195860395-195860417 TCACAGTCCCCCAAAGGCTGTGG + Intergenic
970304426 4:14717085-14717107 TAACATTCTCCCAAAGGATGTGG - Intergenic
971652034 4:29289952-29289974 TAATATTGGCCTAATGACTGTGG + Intergenic
972319375 4:37958942-37958964 TTACATTCCCTCACTGACTCTGG + Intronic
972867569 4:43253193-43253215 TATCATTCCCTCAGTGAATGTGG + Intergenic
975492259 4:75002198-75002220 TAGAATTGCCCAAATGACTGAGG - Intronic
976879850 4:89907026-89907048 GAACATTCTCTGAATGACTGTGG - Intronic
978138499 4:105291464-105291486 TTACTGTCCCCCAGTGACTGTGG + Intergenic
979622153 4:122810780-122810802 TCATATTCCCCTAATGACTAGGG + Intergenic
982284180 4:153717242-153717264 TGACATATCCCCAATCACTGTGG + Intronic
983763608 4:171447292-171447314 TAAGATTTCCTGAATGACTGAGG + Intergenic
985479857 5:102788-102810 TAACACTCCACCAATGGCTTGGG + Intergenic
985623582 5:970292-970314 TAAAACTCCCACAACGACTGTGG - Intergenic
987843816 5:23255747-23255769 TAATATTCTCCCAATGTTTGAGG - Intergenic
990180958 5:53160140-53160162 TAACATTCTACCAATCACTGGGG + Intergenic
996115538 5:119614196-119614218 TCATATTCCCCCTATCACTGTGG + Intronic
999124410 5:149236359-149236381 TAACATTCTCCCAATGCCATAGG - Intronic
1004024942 6:11809119-11809141 TTGCATTCCCCTAATGACTCAGG - Intergenic
1006006085 6:31002714-31002736 AAACCTTCCCCCAAAGACTGAGG - Intergenic
1007664159 6:43504867-43504889 TAACACTCGGGCAATGACTGAGG - Exonic
1008765907 6:54914823-54914845 TAACATACCCTTCATGACTGGGG - Intronic
1014168514 6:118252428-118252450 AACCATTCCCCCGGTGACTGAGG - Intronic
1019854976 7:3596357-3596379 CAACTTTACCACAATGACTGTGG - Intronic
1021125122 7:16843196-16843218 TAACATTGCAGCAATGACTTAGG - Intergenic
1021438466 7:20649482-20649504 AAACATTTTCTCAATGACTGGGG - Intronic
1022415531 7:30173679-30173701 TTACATTCCCCTAACGACTCAGG - Intergenic
1024953671 7:54892928-54892950 TAGCATTCTCCTAATGAGTGGGG - Intergenic
1027332290 7:77110274-77110296 ATACATTCCCCCATTGACTTAGG + Intergenic
1029783490 7:102761053-102761075 ATACATTCCCCCATTGACTTAGG - Intronic
1031153523 7:118082602-118082624 TAAGATTACCCCAGAGACTGGGG + Intergenic
1033890935 7:146012293-146012315 ACACATTCCCCCAATCATTGAGG + Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036188633 8:6648787-6648809 TATCTTTCCCCCACTGACTAGGG + Intergenic
1038516760 8:28193980-28194002 TGCCATTCCCCAAATGTCTGGGG + Intergenic
1043188902 8:77191773-77191795 TTACATTCCCCCAATTATTGAGG + Intergenic
1047707030 8:127509558-127509580 AAAGATTGCCCCAATGAATGGGG - Intergenic
1049016949 8:139927072-139927094 TTACATTTCCCCCATGACTGTGG - Intronic
1055002012 9:71461942-71461964 TAACCTTTCCCCAAAGAGTGAGG - Intergenic
1055387784 9:75782334-75782356 TCACATTTCCCTAATGACTCAGG + Intergenic
1056991783 9:91420136-91420158 AAACATTAACCCAATGACTTGGG + Intronic
1057477627 9:95416459-95416481 TAAAATTTCCCCTATGATTGTGG - Intergenic
1057664942 9:97038148-97038170 TAGCATTTCCCCAAGGACTGTGG + Intronic
1057990015 9:99758728-99758750 TAATATTCCCCCTAATACTGTGG + Intergenic
1058601474 9:106675319-106675341 TACCAAGCCCTCAATGACTGGGG - Intergenic
1061126722 9:128681726-128681748 TAACAGACCCCCAATAACAGTGG + Intergenic
1061345687 9:130023211-130023233 AAAAAATCCCCTAATGACTGGGG + Intronic
1186294350 X:8132598-8132620 AAACATTCCACCAAAGACTCTGG + Intergenic
1187179974 X:16934839-16934861 TAACAATCCCCAAATGTCAGTGG - Intergenic
1189018468 X:37309252-37309274 TAACATTCCCCAATTGACAAGGG - Intergenic
1190455570 X:50624564-50624586 TAACATTCTCCAAGTCACTGGGG + Intronic
1196987622 X:121292419-121292441 TAAAATTGCCCTAATGACTTAGG + Intergenic
1198196764 X:134371269-134371291 TAACATGCCCTTAATGCCTGGGG - Intergenic
1198460129 X:136855244-136855266 TAAAATGCCACCATTGACTGAGG + Intronic
1198795584 X:140390847-140390869 CAACATTGCCCCAATCACTAGGG - Intergenic