ID: 1178463840

View in Genome Browser
Species Human (GRCh38)
Location 21:32828143-32828165
Sequence GCCTGGAGATTCCGCCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178463838_1178463840 0 Left 1178463838 21:32828120-32828142 CCTGTCTGTATTTGAGGGTTCAA No data
Right 1178463840 21:32828143-32828165 GCCTGGAGATTCCGCCCCCTTGG No data
1178463833_1178463840 27 Left 1178463833 21:32828093-32828115 CCTCCCAATAGAAAAAGAACACA No data
Right 1178463840 21:32828143-32828165 GCCTGGAGATTCCGCCCCCTTGG No data
1178463835_1178463840 23 Left 1178463835 21:32828097-32828119 CCAATAGAAAAAGAACACATAAT No data
Right 1178463840 21:32828143-32828165 GCCTGGAGATTCCGCCCCCTTGG No data
1178463834_1178463840 24 Left 1178463834 21:32828096-32828118 CCCAATAGAAAAAGAACACATAA No data
Right 1178463840 21:32828143-32828165 GCCTGGAGATTCCGCCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178463840 Original CRISPR GCCTGGAGATTCCGCCCCCT TGG Intergenic
No off target data available for this crispr