ID: 1178466181

View in Genome Browser
Species Human (GRCh38)
Location 21:32850179-32850201
Sequence TTCGGGGGAGTCGCAAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178466172_1178466181 17 Left 1178466172 21:32850139-32850161 CCCAAACAACTTATTTCACAATT No data
Right 1178466181 21:32850179-32850201 TTCGGGGGAGTCGCAAGAGGGGG No data
1178466171_1178466181 21 Left 1178466171 21:32850135-32850157 CCAGCCCAAACAACTTATTTCAC No data
Right 1178466181 21:32850179-32850201 TTCGGGGGAGTCGCAAGAGGGGG No data
1178466173_1178466181 16 Left 1178466173 21:32850140-32850162 CCAAACAACTTATTTCACAATTT No data
Right 1178466181 21:32850179-32850201 TTCGGGGGAGTCGCAAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178466181 Original CRISPR TTCGGGGGAGTCGCAAGAGG GGG Intergenic
No off target data available for this crispr