ID: 1178468040

View in Genome Browser
Species Human (GRCh38)
Location 21:32866603-32866625
Sequence ACATGCCAGTGGTCCCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178468040_1178468047 20 Left 1178468040 21:32866603-32866625 CCCAAGTGGGACCACTGGCATGT No data
Right 1178468047 21:32866646-32866668 TTTCAATTATTTGTAGAGACAGG No data
1178468040_1178468048 21 Left 1178468040 21:32866603-32866625 CCCAAGTGGGACCACTGGCATGT No data
Right 1178468048 21:32866647-32866669 TTCAATTATTTGTAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178468040 Original CRISPR ACATGCCAGTGGTCCCACTT GGG (reversed) Intergenic
No off target data available for this crispr