ID: 1178472360

View in Genome Browser
Species Human (GRCh38)
Location 21:32904891-32904913
Sequence ATTCAATCAAGTATGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178472360_1178472366 29 Left 1178472360 21:32904891-32904913 CCCAGATTCATACTTGATTGAAT No data
Right 1178472366 21:32904943-32904965 CACTTCAAACTGACCATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178472360 Original CRISPR ATTCAATCAAGTATGAATCT GGG (reversed) Intergenic
No off target data available for this crispr