ID: 1178473055

View in Genome Browser
Species Human (GRCh38)
Location 21:32911872-32911894
Sequence CTGAGGTTTCCCAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178473055_1178473063 29 Left 1178473055 21:32911872-32911894 CCTTCTTCCCTGGGAAACCTCAG No data
Right 1178473063 21:32911924-32911946 GAAGAGGCTCATTCACATTAAGG No data
1178473055_1178473061 13 Left 1178473055 21:32911872-32911894 CCTTCTTCCCTGGGAAACCTCAG No data
Right 1178473061 21:32911908-32911930 GGCCTTTGACTGTTTGGAAGAGG No data
1178473055_1178473060 7 Left 1178473055 21:32911872-32911894 CCTTCTTCCCTGGGAAACCTCAG No data
Right 1178473060 21:32911902-32911924 TCTGAAGGCCTTTGACTGTTTGG No data
1178473055_1178473058 -8 Left 1178473055 21:32911872-32911894 CCTTCTTCCCTGGGAAACCTCAG No data
Right 1178473058 21:32911887-32911909 AACCTCAGTCTTTGCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178473055 Original CRISPR CTGAGGTTTCCCAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr