ID: 1178473348

View in Genome Browser
Species Human (GRCh38)
Location 21:32914904-32914926
Sequence CATTTTCTGCAGTGATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178473345_1178473348 23 Left 1178473345 21:32914858-32914880 CCTACTGGGTTGTGAATCTGCAA No data
Right 1178473348 21:32914904-32914926 CATTTTCTGCAGTGATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178473348 Original CRISPR CATTTTCTGCAGTGATTGGA AGG Intergenic
No off target data available for this crispr