ID: 1178476795

View in Genome Browser
Species Human (GRCh38)
Location 21:32944250-32944272
Sequence ATGCTGAGCCAGCTTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178476795_1178476797 24 Left 1178476795 21:32944250-32944272 CCAATCTCAAGCTGGCTCAGCAT No data
Right 1178476797 21:32944297-32944319 TTAGCAGAGCCAGAGCCCCCAGG No data
1178476795_1178476799 28 Left 1178476795 21:32944250-32944272 CCAATCTCAAGCTGGCTCAGCAT No data
Right 1178476799 21:32944301-32944323 CAGAGCCAGAGCCCCCAGGAGGG No data
1178476795_1178476800 29 Left 1178476795 21:32944250-32944272 CCAATCTCAAGCTGGCTCAGCAT No data
Right 1178476800 21:32944302-32944324 AGAGCCAGAGCCCCCAGGAGGGG No data
1178476795_1178476798 27 Left 1178476795 21:32944250-32944272 CCAATCTCAAGCTGGCTCAGCAT No data
Right 1178476798 21:32944300-32944322 GCAGAGCCAGAGCCCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178476795 Original CRISPR ATGCTGAGCCAGCTTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr