ID: 1178477561

View in Genome Browser
Species Human (GRCh38)
Location 21:32950653-32950675
Sequence GAAAATGCACAAATGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178477561_1178477567 11 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477567 21:32950687-32950709 TTGGATTTGGTACAGAGAAGGGG No data
1178477561_1178477565 9 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477565 21:32950685-32950707 ACTTGGATTTGGTACAGAGAAGG No data
1178477561_1178477563 -8 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477563 21:32950668-32950690 GCATTTTCATTTAATACACTTGG No data
1178477561_1178477564 -2 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477564 21:32950674-32950696 TCATTTAATACACTTGGATTTGG No data
1178477561_1178477568 17 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477568 21:32950693-32950715 TTGGTACAGAGAAGGGGAATAGG No data
1178477561_1178477566 10 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477566 21:32950686-32950708 CTTGGATTTGGTACAGAGAAGGG No data
1178477561_1178477569 18 Left 1178477561 21:32950653-32950675 CCCTTCTTCATTTGTGCATTTTC No data
Right 1178477569 21:32950694-32950716 TGGTACAGAGAAGGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178477561 Original CRISPR GAAAATGCACAAATGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr