ID: 1178479955

View in Genome Browser
Species Human (GRCh38)
Location 21:32971180-32971202
Sequence GTCGGGGCCCAGATATATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178479955_1178479962 15 Left 1178479955 21:32971180-32971202 CCCGCATATATCTGGGCCCCGAC No data
Right 1178479962 21:32971218-32971240 ACAAACAGCTCCATAGCAGCTGG No data
1178479955_1178479964 19 Left 1178479955 21:32971180-32971202 CCCGCATATATCTGGGCCCCGAC No data
Right 1178479964 21:32971222-32971244 ACAGCTCCATAGCAGCTGGTGGG No data
1178479955_1178479966 24 Left 1178479955 21:32971180-32971202 CCCGCATATATCTGGGCCCCGAC No data
Right 1178479966 21:32971227-32971249 TCCATAGCAGCTGGTGGGCTGGG No data
1178479955_1178479965 23 Left 1178479955 21:32971180-32971202 CCCGCATATATCTGGGCCCCGAC No data
Right 1178479965 21:32971226-32971248 CTCCATAGCAGCTGGTGGGCTGG No data
1178479955_1178479963 18 Left 1178479955 21:32971180-32971202 CCCGCATATATCTGGGCCCCGAC No data
Right 1178479963 21:32971221-32971243 AACAGCTCCATAGCAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178479955 Original CRISPR GTCGGGGCCCAGATATATGC GGG (reversed) Intergenic
No off target data available for this crispr