ID: 1178484253

View in Genome Browser
Species Human (GRCh38)
Location 21:33007341-33007363
Sequence AGGTTGCCCAGGCAATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178484248_1178484253 4 Left 1178484248 21:33007314-33007336 CCGAGGCTCTAGTAGGAGGGTGC No data
Right 1178484253 21:33007341-33007363 AGGTTGCCCAGGCAATTTCAGGG No data
1178484244_1178484253 13 Left 1178484244 21:33007305-33007327 CCACTGAGTCCGAGGCTCTAGTA No data
Right 1178484253 21:33007341-33007363 AGGTTGCCCAGGCAATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178484253 Original CRISPR AGGTTGCCCAGGCAATTTCA GGG Intergenic
No off target data available for this crispr