ID: 1178484277

View in Genome Browser
Species Human (GRCh38)
Location 21:33007459-33007481
Sequence CACATTCAGCAACTTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178484277_1178484281 4 Left 1178484277 21:33007459-33007481 CCAATTTCAAGTTGCTGAATGTG No data
Right 1178484281 21:33007486-33007508 TGGGAAAAGATACTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178484277 Original CRISPR CACATTCAGCAACTTGAAAT TGG (reversed) Intergenic
No off target data available for this crispr