ID: 1178485376

View in Genome Browser
Species Human (GRCh38)
Location 21:33016397-33016419
Sequence TGACCACGGTGGCGCTACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178485376_1178485383 26 Left 1178485376 21:33016397-33016419 CCCCTGTAGCGCCACCGTGGTCA No data
Right 1178485383 21:33016446-33016468 ATTAGAAATCATCTTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178485376 Original CRISPR TGACCACGGTGGCGCTACAG GGG (reversed) Intergenic
No off target data available for this crispr