ID: 1178485871

View in Genome Browser
Species Human (GRCh38)
Location 21:33020004-33020026
Sequence GGGCTGCGCAGCGCGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178485871_1178485882 3 Left 1178485871 21:33020004-33020026 CCCGGGCGCGCGCTGCGCAGCCC No data
Right 1178485882 21:33020030-33020052 GGGGCCGGGGAGACACCGCTCGG No data
1178485871_1178485886 18 Left 1178485871 21:33020004-33020026 CCCGGGCGCGCGCTGCGCAGCCC No data
Right 1178485886 21:33020045-33020067 CCGCTCGGGAGTCCTCCGCTCGG No data
1178485871_1178485878 -10 Left 1178485871 21:33020004-33020026 CCCGGGCGCGCGCTGCGCAGCCC No data
Right 1178485878 21:33020017-33020039 TGCGCAGCCCCGCGGGGCCGGGG No data
1178485871_1178485883 4 Left 1178485871 21:33020004-33020026 CCCGGGCGCGCGCTGCGCAGCCC No data
Right 1178485883 21:33020031-33020053 GGGCCGGGGAGACACCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178485871 Original CRISPR GGGCTGCGCAGCGCGCGCCC GGG (reversed) Intergenic
No off target data available for this crispr