ID: 1178485920

View in Genome Browser
Species Human (GRCh38)
Location 21:33020193-33020215
Sequence CCCGGGCTTCGGGCCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178485920_1178485941 30 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485941 21:33020246-33020268 GACCCCCGGCTCAGGCGGGAGGG No data
1178485920_1178485931 8 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485931 21:33020224-33020246 CCGGCCCATCTCCGGCTCCGCGG No data
1178485920_1178485929 0 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485929 21:33020216-33020238 GACAGTGGCCGGCCCATCTCCGG No data
1178485920_1178485936 22 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485936 21:33020238-33020260 GCTCCGCGGACCCCCGGCTCAGG No data
1178485920_1178485938 25 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485938 21:33020241-33020263 CCGCGGACCCCCGGCTCAGGCGG No data
1178485920_1178485939 26 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485939 21:33020242-33020264 CGCGGACCCCCGGCTCAGGCGGG No data
1178485920_1178485940 29 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485940 21:33020245-33020267 GGACCCCCGGCTCAGGCGGGAGG No data
1178485920_1178485934 16 Left 1178485920 21:33020193-33020215 CCTGGGGAGGCCCGAAGCCCGGG No data
Right 1178485934 21:33020232-33020254 TCTCCGGCTCCGCGGACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178485920 Original CRISPR CCCGGGCTTCGGGCCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr