ID: 1178487287

View in Genome Browser
Species Human (GRCh38)
Location 21:33027061-33027083
Sequence GGGGACAAGCTAGGAGGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178487278_1178487287 18 Left 1178487278 21:33027020-33027042 CCGAGCTGCGCGGCGCTATGGGC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1178487287 21:33027061-33027083 GGGGACAAGCTAGGAGGCAGTGG 0: 1
1: 0
2: 2
3: 41
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178487287 Original CRISPR GGGGACAAGCTAGGAGGCAG TGG Exonic
900164829 1:1240499-1240521 GGGCAGAAACCAGGAGGCAGAGG + Intergenic
900981352 1:6047902-6047924 GGGGACAAGCTCGTAGCAAGAGG + Intronic
901234515 1:7660837-7660859 GGGGCCAGGCTCAGAGGCAGTGG - Intronic
901530702 1:9850831-9850853 CAGGACAAGCAAGGAGGCTGCGG + Intronic
902195419 1:14794523-14794545 GGGGCCAGGGTAGGAGGCAGCGG + Intronic
902600152 1:17535463-17535485 GGGGCCAGACTGGGAGGCAGCGG + Intergenic
902647551 1:17811949-17811971 GAGGCCAAGCCAGGAGGCAGAGG - Intronic
902673908 1:17995038-17995060 TGGGAGAACCTGGGAGGCAGAGG - Intergenic
902786231 1:18734387-18734409 GGGGAGAGGGTAGGAGGGAGAGG - Intronic
903204181 1:21768121-21768143 GGCGTGAAGCTGGGAGGCAGAGG + Intronic
904031262 1:27534828-27534850 GGGGGCAGGGTGGGAGGCAGAGG + Exonic
904036428 1:27561466-27561488 GGGGAGCTGCTGGGAGGCAGAGG + Intronic
904346627 1:29876640-29876662 GGGCACAAGATAGGGGGCTGGGG - Intergenic
904767975 1:32864804-32864826 GGGGACAAGTGAGCAGTCAGAGG + Intronic
904911362 1:33936751-33936773 GGGGACAAGGCAGAGGGCAGGGG - Intronic
905037499 1:34927677-34927699 GGGGAGAAGAGAGGAGGGAGGGG - Intronic
905410628 1:37765626-37765648 GGGGATGAGCTAGGAGACACCGG - Intergenic
905642061 1:39596810-39596832 GGGGAGAGGCCAGGAGGAAGAGG - Intergenic
905959626 1:42032816-42032838 GGAGACCAGTTAGGAGGCCGTGG - Intronic
906003295 1:42445839-42445861 GGAGACCAGTTAGTAGGCAGTGG + Intronic
906052419 1:42886613-42886635 TGGGACAACCCAGGAGGCTGCGG - Intergenic
906128401 1:43441672-43441694 AGGCACAACCTAGGAGGCAGAGG - Exonic
906248096 1:44291121-44291143 GGGGTCAAGCTAGGAAATAGGGG + Intronic
906502303 1:46350280-46350302 CAGCACAAGCTAGGAGGCTGAGG + Intronic
906685399 1:47760084-47760106 GGGGCCTGGCTAGGTGGCAGGGG + Intergenic
906945629 1:50292009-50292031 GGGGGCCAGATGGGAGGCAGGGG + Intergenic
906952639 1:50347298-50347320 TGGGCCAAGCTAGGATACAGAGG - Intergenic
907305272 1:53509696-53509718 TGAGAGAAGCTAGGAGACAGGGG - Intronic
908422551 1:63973134-63973156 GGAGACAAGCTAGGAGGGCAGGG - Intronic
909304199 1:74051648-74051670 GGGGAGATGGTAGGAGACAGGGG - Intronic
910095706 1:83519396-83519418 AGGGACAAGCCAGGTGGCTGGGG + Intergenic
910247780 1:85160639-85160661 GGGGAAAAGCAAGGAGATAGTGG - Intronic
910414678 1:86984820-86984842 CGGGAGAACCTGGGAGGCAGAGG + Intronic
912244456 1:107946173-107946195 GGAGACTAATTAGGAGGCAGTGG + Intronic
912296078 1:108472276-108472298 GGGGACAAGGTGGGAGACATAGG - Intergenic
914435850 1:147658713-147658735 GGGGAGAAGCCAGGAGCCAGAGG + Intronic
914895400 1:151667131-151667153 CGGTCCAAGCTAGGAGGCTGAGG + Intronic
915156456 1:153880513-153880535 GGTGAGGAGCAAGGAGGCAGGGG - Intronic
915595766 1:156895512-156895534 GGGGAGAAGCCAGAAGGAAGAGG + Intronic
915599729 1:156914614-156914636 GAGGACAAGATAAGAGGGAGTGG - Intronic
915605018 1:156945005-156945027 GAGTTCAAGGTAGGAGGCAGAGG - Exonic
915849162 1:159302559-159302581 GGAGCCAAGCTAGAAAGCAGAGG + Intronic
916569431 1:166012282-166012304 GGAGACACTGTAGGAGGCAGTGG - Intergenic
917973322 1:180222470-180222492 GAGGACAGGCTGTGAGGCAGGGG - Intergenic
920067921 1:203282215-203282237 GGAGACAAGGTAGGAGGGTGAGG + Intergenic
920100722 1:203515477-203515499 GGGGACAAGCCTGGAGTCTGAGG + Intergenic
922466486 1:225848457-225848479 GGCGACAAGCTCAGAGGCTGAGG + Intronic
922774388 1:228208126-228208148 GGGCACAGGCTGGGAGGCAGGGG - Exonic
922820213 1:228479432-228479454 GGGGACCACCCAGGAGGAAGGGG + Intergenic
923035744 1:230283931-230283953 GGGGACAGCCTGGGAGGAAGAGG + Intergenic
923086397 1:230706302-230706324 GGGGCCAAGGAAGGAGGCTGAGG - Intronic
923896657 1:238277341-238277363 GGGGTGAACCCAGGAGGCAGAGG + Intergenic
924012331 1:239679291-239679313 GGGGGCAGGGGAGGAGGCAGAGG - Intronic
924417135 1:243868527-243868549 AGGGACATGGAAGGAGGCAGGGG - Intergenic
1063095297 10:2903625-2903647 AGGGACACGCTGGGAGGCTGTGG - Intergenic
1063695020 10:8326524-8326546 GGGGACAAGAGAGGAGGGCGAGG - Intergenic
1064248473 10:13688795-13688817 TGAGCCTAGCTAGGAGGCAGAGG - Intronic
1065119798 10:22517232-22517254 GGGTACATGCCAGGAGGCGGGGG - Intergenic
1065449700 10:25844114-25844136 GGGGACAAGGTGGGAGTGAGAGG - Intergenic
1066119370 10:32269250-32269272 GGGAACAAGCTAGCAAGTAGAGG + Intronic
1066243940 10:33563673-33563695 AGAGACAAGCCAGGAGACAGAGG + Intergenic
1067084537 10:43230785-43230807 GCAAACAAGCTGGGAGGCAGAGG - Intronic
1067095776 10:43298689-43298711 TGGGACAGGTTAGGAGGCCGAGG - Intergenic
1067815935 10:49476892-49476914 GGGGTCCAGGTAGGTGGCAGAGG - Intronic
1068645171 10:59457999-59458021 GGGGACCAGCTGGGAGGCTGTGG + Intergenic
1068911457 10:62382528-62382550 GGGGATGTGATAGGAGGCAGGGG - Intronic
1069408415 10:68127092-68127114 GGGGAATTGCTTGGAGGCAGGGG - Intronic
1069416425 10:68204852-68204874 GGGGACTAGGAAGAAGGCAGGGG - Intronic
1069677663 10:70260202-70260224 GGGAACCAGCAAGGAGCCAGTGG + Intronic
1069694543 10:70376995-70377017 GGGGACCAGCTTAGAGGCTGTGG - Intronic
1069779286 10:70944714-70944736 GGAGACCAGCTGGGGGGCAGAGG - Intergenic
1069881657 10:71597240-71597262 GGAGACCAGCTAGGGGACAGAGG - Intronic
1069962552 10:72087418-72087440 GGGGAGCAGCTCGGAGCCAGAGG - Intronic
1071276443 10:84059799-84059821 GGGCAGGAGCTAGCAGGCAGGGG + Intergenic
1071786490 10:88906086-88906108 GGGGACAAGTTGGGAGACACAGG + Intronic
1072463396 10:95640977-95640999 GGAGACAAGCTGGAAAGCAGAGG - Intronic
1072708731 10:97701610-97701632 CGGGACACTGTAGGAGGCAGGGG + Intergenic
1073115241 10:101088034-101088056 GGGGGGAAGCTGGGAGGAAGGGG + Intergenic
1074856402 10:117477195-117477217 GAGGAGAGGCTAGGAGGAAGAGG + Intergenic
1076293551 10:129366224-129366246 GTGGCCAACCGAGGAGGCAGAGG + Intergenic
1076570918 10:131432389-131432411 GGGAACCTGCTGGGAGGCAGCGG + Intergenic
1076738320 10:132468482-132468504 GGGGAGGAGATGGGAGGCAGGGG + Intergenic
1077223108 11:1426058-1426080 GCGCACAGGCTAGGAGCCAGGGG - Intronic
1077300203 11:1843196-1843218 GAGGACAAGTGTGGAGGCAGAGG + Intergenic
1079286814 11:19141481-19141503 GTGGACAAGCAGGCAGGCAGAGG - Intronic
1079330812 11:19531396-19531418 GGGGGCCAGTTAGGAGGCAATGG + Intronic
1079649207 11:22905787-22905809 TGAGATAAGCTAGGAGGCAATGG - Intergenic
1080401246 11:31937997-31938019 TGGGAGAATCTGGGAGGCAGAGG - Intronic
1080649103 11:34208920-34208942 GGGGGTAAGCCTGGAGGCAGGGG - Intronic
1080743091 11:35083602-35083624 GGGGACAAGCTAAGGAGAAGAGG + Intergenic
1081097920 11:38963603-38963625 GGGAACAGGCTAGGAATCAGAGG - Intergenic
1081782117 11:45720409-45720431 GGGGAAAAGCAAGTAGGGAGAGG - Intergenic
1082880266 11:58030140-58030162 GGGAACAAGATAAGAGCCAGAGG - Intronic
1084669541 11:70596879-70596901 GGGCACAGGCTTGGAGGCAAGGG + Intronic
1085301959 11:75463852-75463874 GGGAACAAGCCCAGAGGCAGTGG - Intronic
1085936588 11:81153061-81153083 AGGGAGAAGCTAGGTTGCAGTGG - Intergenic
1086181812 11:83960969-83960991 GGGAACAGGAAAGGAGGCAGGGG + Intronic
1086297598 11:85388169-85388191 GGGGAAAAGCTAGCAGCCACTGG - Intronic
1088582054 11:111325978-111326000 GAGGAAAATCAAGGAGGCAGAGG - Intergenic
1088755760 11:112883877-112883899 GGGCACAGGCCAGGAGGCAGGGG + Intergenic
1088920715 11:114258176-114258198 GGGGACAGGCACCGAGGCAGGGG + Intronic
1089224139 11:116901401-116901423 GAGGGACAGCTAGGAGGCAGAGG - Intronic
1089391543 11:118105489-118105511 GGGTACTAGCTGGGAGGTAGAGG + Intronic
1089487270 11:118856322-118856344 GGAGACTAGCTGGGAGGTAGGGG + Intergenic
1089618135 11:119706725-119706747 GGTGACAAGGAAGGAAGCAGAGG - Intronic
1089810603 11:121128306-121128328 GAGGTCAAGATAGGAGGCATCGG + Exonic
1090658625 11:128864764-128864786 GGGGACAGGCGAGGATGAAGTGG - Intronic
1090715278 11:129424836-129424858 GAGCACAAGCTATGAGGCAGAGG + Intronic
1090855276 11:130605411-130605433 GGGGACAAGCGAGGATGCCTGGG - Intergenic
1090924678 11:131239118-131239140 GTGGACAAGATAGGACACAGAGG - Intergenic
1091114555 11:133000943-133000965 GGGAGCAAGAAAGGAGGCAGGGG - Intronic
1091227296 11:133965169-133965191 GGGGACCAGACAGGGGGCAGAGG + Intergenic
1092229039 12:6766711-6766733 GGAGAAAAGCGTGGAGGCAGCGG + Exonic
1094342891 12:29432492-29432514 GAGGAAGAGCTTGGAGGCAGGGG + Intronic
1096258303 12:50075820-50075842 GGGGACATTCAAGGAGGCTGTGG + Intronic
1096800564 12:54107604-54107626 AGGGAAAAGCTTGCAGGCAGAGG - Intergenic
1098947480 12:76604878-76604900 GGAGACAAGTTAGGAGGCTATGG - Intergenic
1099438113 12:82667868-82667890 GGGGACAAGCTAGTGAGAAGGGG - Intergenic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1100598847 12:96094953-96094975 GGAGACCAGGTAGGAGGCTGCGG + Intergenic
1101257522 12:102993137-102993159 AAGCAGAAGCTAGGAGGCAGAGG + Intergenic
1101270867 12:103142996-103143018 GGGGGCAAGGTTGGAGGCTGGGG + Intergenic
1101690810 12:107078915-107078937 GGGGAAAGGCTATGAGGAAGGGG - Intronic
1101975985 12:109359281-109359303 GGGGACAAGCAAAGTAGCAGAGG + Intronic
1102009135 12:109607261-109607283 GGGATAAAGCGAGGAGGCAGGGG + Intergenic
1102061479 12:109935467-109935489 GCGGAGAAGCCAGGAGGCGGAGG - Intronic
1103552730 12:121748211-121748233 GGGTAGAAGGTAGGAGGCACTGG + Intronic
1103576695 12:121882823-121882845 CAGGAGAAGCTGGGAGGCAGAGG - Intergenic
1104383343 12:128327464-128327486 GGTGAGAAGCCAGGAGGCGGAGG - Intronic
1104816328 12:131648038-131648060 GAGGAGAAGCAAGGAGGTAGAGG - Intergenic
1104973702 12:132542696-132542718 GGGGAGGAGATAGGAGACAGAGG - Intronic
1105432880 13:20352828-20352850 GAGGACAGGCTAGGAGGTAGTGG + Intergenic
1105788243 13:23770587-23770609 GAGGCCAAGCTGGCAGGCAGGGG - Intronic
1105794141 13:23834017-23834039 GGGGTCAGGGTGGGAGGCAGGGG - Intronic
1106228407 13:27802318-27802340 GGAGAGAACCTGGGAGGCAGAGG + Intergenic
1106234877 13:27853273-27853295 AGGGAAAAGCTGGGAGGTAGGGG + Intergenic
1106453803 13:29909505-29909527 GGTGACATGGTGGGAGGCAGTGG - Intergenic
1106593372 13:31116893-31116915 GGGGGTAAGCTGGGAGGAAGAGG + Intergenic
1109114271 13:58361107-58361129 GGGGATACTCTAGGAGCCAGTGG + Intergenic
1109430022 13:62220017-62220039 TGGGTCAGGCTGGGAGGCAGGGG - Intergenic
1111987976 13:95084323-95084345 GGGGACAAGCTAAAATGTAGTGG - Intronic
1113268412 13:108645063-108645085 GGGGACAAGACAAGAGGCAGTGG + Intronic
1113313630 13:109156666-109156688 GGGGAAAGGCCAGGAAGCAGGGG - Intronic
1114423228 14:22602047-22602069 GGGGAGAAGGAAGGAGGAAGGGG - Intronic
1115191772 14:30754475-30754497 GGGTACAGGCAAGGAGGCAGTGG - Intergenic
1116861607 14:50000210-50000232 GGAGAGAAGCGAGGGGGCAGGGG + Intronic
1117154926 14:52929337-52929359 GGAGACCAGTTAGGAGGCTGTGG - Intronic
1118981354 14:70719260-70719282 GGGGACAACCTTGAAGCCAGTGG + Intergenic
1119248987 14:73136375-73136397 GGGGAGGAGCCAGGAGGAAGGGG - Intergenic
1120663114 14:87274192-87274214 GGGGACATGGAAGGAGGAAGTGG + Intergenic
1121714750 14:96065631-96065653 GGGGTCAGGCTAGAAGCCAGAGG - Intronic
1122194846 14:100077184-100077206 GGGGAACAGCTAGGAGGCTGTGG + Intronic
1122247599 14:100414983-100415005 GGGGAGCAGCAAGGGGGCAGAGG + Intronic
1122986577 14:105214372-105214394 GGAGACAAGCTCGGAGGGAGCGG + Intronic
1123114981 14:105890507-105890529 GGGGTCCAGCTGGGAGGAAGTGG + Intergenic
1123117167 14:105899955-105899977 GGGGTCCAGCTGGGAGGAAGGGG + Intergenic
1125067117 15:35500840-35500862 AGGGAGAACCTGGGAGGCAGAGG - Intronic
1126633430 15:50759657-50759679 GGCGTGAAGCCAGGAGGCAGAGG + Intronic
1127857954 15:62967902-62967924 GAGGACAAGCAGGGAGGGAGTGG - Intergenic
1128065631 15:64762898-64762920 GGGGACAAGATGGAAGTCAGGGG + Intronic
1128639050 15:69322383-69322405 GAGGATAAGACAGGAGGCAGAGG + Intronic
1128791916 15:70440129-70440151 AGGGACAGGCTAGGAGGCTCTGG + Intergenic
1128972387 15:72118626-72118648 GGGGACAATGGAGGGGGCAGTGG - Intronic
1129992066 15:79974038-79974060 GGGCACAGTCTAGGAGGCACGGG - Intergenic
1130109751 15:80954439-80954461 GGGGGCTAGGTAGGCGGCAGAGG + Intronic
1130557156 15:84930687-84930709 GGGTAGAACCCAGGAGGCAGAGG - Intronic
1130959921 15:88652609-88652631 GGGGACAGGGGAGGAGGAAGGGG - Intronic
1131118439 15:89808582-89808604 GGGGACAAGCTGGGAGACAGAGG - Intronic
1131267522 15:90926206-90926228 GGCGAGAACCCAGGAGGCAGAGG + Intergenic
1131419004 15:92287884-92287906 GGGGAGCAGCCAGGAGGCAGTGG - Intergenic
1131669021 15:94599731-94599753 GGGGCAGAGCTAGGAGGGAGGGG + Intergenic
1132768245 16:1546015-1546037 GGGGAGAAGCTAGGGGTCTGTGG - Intronic
1133045588 16:3086782-3086804 GGGGAGAGGCAAGAAGGCAGAGG + Intergenic
1133319327 16:4903208-4903230 TGGGACAAGGCAGGAGTCAGGGG + Intronic
1133379176 16:5315556-5315578 GGGGCCAGGCAAAGAGGCAGGGG + Intergenic
1133931592 16:10237146-10237168 AGGGAGAATCTGGGAGGCAGAGG - Intergenic
1134031381 16:10995270-10995292 GAGGAGAAGGTAGGAAGCAGTGG + Intronic
1134249640 16:12565482-12565504 GGACACAGGCTTGGAGGCAGGGG - Intronic
1135576174 16:23587548-23587570 GGGTTGAAGCCAGGAGGCAGAGG - Intronic
1135590163 16:23699308-23699330 GGGGCCAAGGTATGAGGAAGTGG + Intronic
1136368619 16:29821637-29821659 GACCACAAACTAGGAGGCAGTGG - Intronic
1136501294 16:30670688-30670710 GGGCCCAACCTAGAAGGCAGGGG + Exonic
1137485718 16:48889144-48889166 GGGGCCAGGCAGGGAGGCAGTGG - Intergenic
1138406811 16:56802115-56802137 GGGTAGAAGTTAGGAGGCAGGGG - Intronic
1138625009 16:58244563-58244585 GGGGAGACGTTAAGAGGCAGAGG + Intronic
1138627866 16:58266753-58266775 GGGGCCAATCTAAGAAGCAGGGG + Intronic
1139171509 16:64635616-64635638 GGGGACAAACAACGAGGCTGAGG - Intergenic
1139385319 16:66565114-66565136 GGTCAGAACCTAGGAGGCAGTGG + Intronic
1139512232 16:67434027-67434049 GGGAACAATCAAGGAGGCAGGGG + Intronic
1139766179 16:69232287-69232309 GGCGTGAACCTAGGAGGCAGAGG - Intronic
1139953448 16:70682563-70682585 GGGGACAAGATGGGGCGCAGGGG + Intronic
1140084034 16:71777807-71777829 GGAGAAAAGCATGGAGGCAGTGG - Intronic
1140192578 16:72830456-72830478 GTGAACATGCCAGGAGGCAGTGG + Intronic
1140864199 16:79045616-79045638 AAGGACCAGCTTGGAGGCAGAGG + Intronic
1141985171 16:87575233-87575255 CTGGAGAAGCTGGGAGGCAGTGG - Intergenic
1143023187 17:3927163-3927185 GGGGACAGGCTAGGAGGGCTGGG - Intronic
1143151982 17:4812898-4812920 GAGGAGAAGCTGGGAGTCAGTGG + Intronic
1143950732 17:10630471-10630493 TGGGACTTGCTAGGATGCAGAGG + Intronic
1144035634 17:11363006-11363028 CTGGACATGCTAGGAGGCAGAGG - Intronic
1145042001 17:19583899-19583921 GTGGAAAAGCTGGGAGCCAGGGG + Intergenic
1145866349 17:28244374-28244396 GTTGACAATCTAGGAGGAAGTGG - Intergenic
1145999425 17:29122424-29122446 GTGGGGAAGCTAGGAGGCAAGGG + Intronic
1146175858 17:30666267-30666289 GGGCAGAAGCCAGGAGGCTGTGG + Intergenic
1146349310 17:32082372-32082394 GGGCAGAAGCCAGGAGGCTGTGG + Intergenic
1146477589 17:33175723-33175745 GGGGAGAAGCAAGGAGGGAGAGG - Intronic
1146499449 17:33352015-33352037 GAGGACCATCTAGGAGGCTGAGG - Intronic
1146565020 17:33905457-33905479 GAGGACAAGCTATGATGCAAGGG - Intronic
1146800232 17:35813041-35813063 TGGTTGAAGCTAGGAGGCAGAGG + Intronic
1147330407 17:39696009-39696031 GGGGTCTAGCTAGGGGGCTGGGG - Intronic
1147706519 17:42429120-42429142 GAGGAGAATCTGGGAGGCAGAGG - Intergenic
1147717651 17:42519177-42519199 GGGGCCCAGCAAGGAGGAAGAGG - Intronic
1147925736 17:43944454-43944476 GGTGACAATCCAGGAGGAAGTGG + Intergenic
1148602946 17:48908180-48908202 GGGGAGAAGAGAGGAGGGAGTGG - Intergenic
1148748011 17:49929171-49929193 GGGGAGAAGTCAGGAAGCAGAGG + Intergenic
1149564558 17:57631709-57631731 GGGGAAAAGAGAGGAAGCAGGGG - Intronic
1149867467 17:60158631-60158653 GGGGGCTAGACAGGAGGCAGGGG + Intronic
1150947741 17:69765758-69765780 GGGGAGAAGGTAGAAGGGAGGGG - Intergenic
1151408651 17:73906179-73906201 GGGGAGGTGGTAGGAGGCAGTGG + Intergenic
1151969620 17:77450986-77451008 GGGGAGCACCTAGGAAGCAGGGG + Intronic
1152023214 17:77792685-77792707 GGCCACAAGCTAGGAGGCAGGGG + Intergenic
1152066081 17:78113186-78113208 TGGGACAACCGAGGAGGCTGCGG - Exonic
1152193183 17:78900969-78900991 CTGGCCATGCTAGGAGGCAGTGG + Intronic
1152300511 17:79492844-79492866 TGGGACACGCCAGGAGGCAGTGG + Intronic
1152696035 17:81796067-81796089 GGGGACAAGCCGGGAGGCCCCGG - Intergenic
1152702195 17:81824672-81824694 GGGGACACCCTGGTAGGCAGAGG - Exonic
1155084173 18:22440452-22440474 GGGCACAGGCTAGGAGTTAGGGG - Intergenic
1156605974 18:38667938-38667960 GGGGCCATGATAGGAGGCAGTGG + Intergenic
1157357637 18:46950020-46950042 GAGGAAAAGCATGGAGGCAGAGG - Intronic
1159023747 18:63164518-63164540 GGGGAAAGACTGGGAGGCAGTGG + Intronic
1159087477 18:63809946-63809968 GGGGAGAAGCTGGATGGCAGGGG + Intergenic
1159951863 18:74489948-74489970 GGGAACAAGGGAGGAGGGAGGGG + Intergenic
1160039270 18:75331214-75331236 GGGGAAAAACCAGGAGGCAGAGG - Intergenic
1160928227 19:1557017-1557039 GGGCACAGGCTGGGAGGTAGGGG - Intronic
1160975397 19:1790222-1790244 GGGGAGGAGAGAGGAGGCAGAGG - Intronic
1161713207 19:5861622-5861644 GGGAACTAGGCAGGAGGCAGGGG - Intergenic
1162116131 19:8430630-8430652 GGGGAGAGGATAGGGGGCAGAGG - Intronic
1162346194 19:10119445-10119467 GGGGAACAGCTGGGAGGCAGTGG + Intronic
1162897627 19:13774826-13774848 GGGGACGAGCTAGGAGCGAGGGG + Intronic
1163571031 19:18082433-18082455 GAGGACAAGTTAGGAGGCTGAGG - Intronic
1164616953 19:29673028-29673050 GAGGCGATGCTAGGAGGCAGGGG - Intronic
1165813756 19:38628410-38628432 GCTGAGAAGCTAGGAGGAAGCGG - Intronic
1167209320 19:48123105-48123127 GGGGACAGGCTGGGAGGCCGGGG + Intronic
1167467646 19:49658557-49658579 GGGGACAGGCTTGGGGGCAAGGG - Exonic
1167609006 19:50497216-50497238 GGGGCCGAGCTGAGAGGCAGAGG + Intergenic
1168021051 19:53608869-53608891 GGTGTGAAGCTGGGAGGCAGAGG + Intergenic
925307673 2:2861737-2861759 GGGAACAGCCTAGGAGGCAAAGG - Intergenic
925576996 2:5370427-5370449 GGTGACAAGCTCAGTGGCAGTGG - Intergenic
925611570 2:5706374-5706396 GTGGAGAAGCTGGGAGGCTGGGG + Intergenic
925611599 2:5706462-5706484 GTGGAGAAGCTGGGAGGCTGGGG + Intergenic
925791918 2:7498204-7498226 GGTGACAAGGTAGGAAGGAGAGG + Intergenic
926028401 2:9564764-9564786 GGGGTGAACCTGGGAGGCAGAGG - Intergenic
926117815 2:10224467-10224489 GGGGACATGAAAGGAGGCAGAGG - Intergenic
926134239 2:10325503-10325525 GGGGACAAGCAGAGAGGCACAGG - Intronic
927843984 2:26462005-26462027 GGGGGCAGGAGAGGAGGCAGAGG - Intronic
928001446 2:27526352-27526374 TGGGACCAGGTAGGAGACAGAGG + Intergenic
928331526 2:30361360-30361382 TAGGGCAAGCCAGGAGGCAGGGG + Intergenic
931260319 2:60612420-60612442 GGAGACCAGTTAGGAGGCTGTGG + Intergenic
931860154 2:66346215-66346237 GGGCACAGGCAAGGAGGAAGAGG + Intergenic
932321962 2:70828980-70829002 GAGCAGAAGCTATGAGGCAGGGG - Intergenic
932406769 2:71518121-71518143 TGGGACAAGTGAGGAGGCTGGGG - Intronic
932953862 2:76327822-76327844 TGGGACAAGGAAGGATGCAGAGG + Intergenic
933637288 2:84721910-84721932 GGGGAAGAGAGAGGAGGCAGGGG + Intronic
933812524 2:86041815-86041837 GGGCAGGGGCTAGGAGGCAGGGG + Intronic
934573138 2:95384563-95384585 AGGGACCAGCTGGGGGGCAGGGG + Exonic
934745305 2:96755839-96755861 GGGGATTACCTGGGAGGCAGAGG - Intergenic
935106079 2:100044950-100044972 GGGAACAAGCTAGGGGGATGTGG + Intronic
935805503 2:106743620-106743642 GTGGACAGAGTAGGAGGCAGAGG - Intergenic
936004025 2:108865981-108866003 GGGGAGAAGCTAGGAGCTGGGGG + Intronic
936415974 2:112312295-112312317 GGGGACAAGAAGGGAGGCAGTGG + Intronic
937012422 2:118574320-118574342 GGATAGAAGCTAGGAGTCAGGGG - Intergenic
937043593 2:118838921-118838943 AGGGCCAAGCTACAAGGCAGGGG - Intergenic
937241773 2:120466472-120466494 GGGGAGAAGCTCAAAGGCAGGGG + Intergenic
937728589 2:125198054-125198076 GGGGACATGATAAGAGACAGAGG + Intergenic
938118738 2:128619537-128619559 GGGGTCAAGGTCGGAGGGAGTGG + Intergenic
938592740 2:132755179-132755201 GAGGACAATCTGGGAGGAAGAGG + Intronic
938659551 2:133471537-133471559 GGGGGGAAGCAAGCAGGCAGAGG + Intronic
939003574 2:136762167-136762189 GGGGACAAAATAGGAGGAAAGGG - Intergenic
941385103 2:164842025-164842047 GGGGACCAGCTCGGCGGCATTGG + Intronic
942202226 2:173582850-173582872 GGGGACAGGCCAGAGGGCAGAGG - Intergenic
943218158 2:185066094-185066116 GGAGATCAGCTAGGAGGCCGGGG - Intergenic
943878215 2:193102057-193102079 GGGGACCAGCCTGGAGCCAGGGG + Intergenic
943912150 2:193583277-193583299 GGGGAGAAGCCAGGAGACAATGG + Intergenic
946399502 2:219461044-219461066 GGGGAGAACCTAGGGGGCTGTGG + Intronic
946418899 2:219553933-219553955 GGGGAGAAGCTGGGGGCCAGAGG + Intronic
947188232 2:227472967-227472989 GGGAAGACGCTAGGAGGCCGGGG + Intronic
947632113 2:231660769-231660791 GGGGTCAAAGTAGAAGGCAGAGG - Intergenic
947691578 2:232141739-232141761 GGTGAAAAGCTAGGAGACAAAGG - Intronic
948884429 2:240875714-240875736 AGGGCCCAGCCAGGAGGCAGTGG - Intronic
1168852442 20:985842-985864 GGGGAGAAGCTATGAACCAGAGG + Intronic
1168931210 20:1625803-1625825 TGGGACAAGTGAGGAGTCAGTGG + Intergenic
1169253065 20:4074956-4074978 GTGGACAAGCCAGAAGGCTGAGG + Exonic
1171463266 20:25310601-25310623 AGGGCCAGGCTGGGAGGCAGGGG + Intronic
1172409189 20:34709580-34709602 GGGTCCAGGCTAGGAGGCTGGGG + Intronic
1172410442 20:34717980-34718002 GGGAACAAGCAAGGAAGGAGGGG - Intronic
1172451970 20:35032553-35032575 GGCGAGAACCTGGGAGGCAGAGG - Intronic
1172635673 20:36408120-36408142 GGGGCCAAGCCAGGAGGCTTGGG + Intronic
1172945155 20:38681582-38681604 GGGGACAATGTAGGGGGCTGTGG + Intergenic
1173113545 20:40218545-40218567 GGGGAGAAGGAAGGAGGCAGTGG - Intergenic
1173468300 20:43301962-43301984 GGGGACCAGCTCTGAGTCAGTGG - Intergenic
1174058320 20:47815016-47815038 TGGGACAAGCTGGGAGTAAGAGG + Intergenic
1176011817 20:62901008-62901030 GGGAACAATCAAGGTGGCAGCGG + Intronic
1176058523 20:63161483-63161505 GAGGTCAAGGGAGGAGGCAGAGG - Intergenic
1178487287 21:33027061-33027083 GGGGACAAGCTAGGAGGCAGTGG + Exonic
1179512262 21:41880862-41880884 GGGGACAAGCAGGGAGACAGTGG - Intergenic
1179656621 21:42849970-42849992 AGGGACATGCCAGGATGCAGGGG + Exonic
1179911135 21:44449578-44449600 TGGGACAGGCTGGGAGCCAGGGG + Intergenic
1180095961 21:45555381-45555403 GGGGACAGTATGGGAGGCAGGGG + Intergenic
1180927855 22:19568460-19568482 GGCGAGAAGCTAGGAGCGAGAGG + Intergenic
1181095197 22:20500196-20500218 GGGTTGAATCTAGGAGGCAGAGG + Intronic
1182831451 22:33307850-33307872 GGAGAGAACCTAGGAGGTAGAGG - Intronic
1183358230 22:37370592-37370614 GGGGACAAGGGAGGTGGCAGTGG + Exonic
1184096654 22:42319781-42319803 GTGGACAGGCGAGGAGGCCGGGG + Intronic
1184190886 22:42893622-42893644 GAGAACCAGCTGGGAGGCAGGGG + Intronic
1184253849 22:43276111-43276133 GGGGACGCGCTAGGAAGCACAGG + Intronic
1184346672 22:43917880-43917902 AGGGACAAGGCAGGAGGCTGTGG - Intergenic
949871785 3:8595400-8595422 GGAGGCAAGCCATGAGGCAGTGG - Intergenic
950171229 3:10840267-10840289 GGGCAAAAGCCAGGAGGCTGGGG - Intronic
950440675 3:13008462-13008484 GGGGGCCAGCCAGGTGGCAGAGG - Intronic
950477368 3:13222662-13222684 GGGGCCAAGCTCGGTGGTAGAGG + Intergenic
950548687 3:13653843-13653865 GTGGAGAAGAGAGGAGGCAGAGG - Intergenic
950704907 3:14773539-14773561 GGGAACAAGTAAGGAGGGAGGGG + Intergenic
952225762 3:31374180-31374202 CAAGACAAGCTAGGAGGCATTGG - Intergenic
953474485 3:43194130-43194152 GGGGCCACGAGAGGAGGCAGAGG - Intergenic
954893204 3:53951696-53951718 GGGGACAAGTTAGAAGGAATTGG - Intergenic
954898585 3:53998713-53998735 GGGGATGAGCTTGGTGGCAGGGG + Intergenic
955095403 3:55792301-55792323 GGGAACAGGCAAGAAGGCAGAGG + Intronic
955671655 3:61408976-61408998 GGGGTCAAGATTGGATGCAGGGG - Intergenic
956060312 3:65342164-65342186 GGAGAGAATCCAGGAGGCAGTGG + Intergenic
959963944 3:112333085-112333107 GGGGGCTAGCGAGGAGGAAGAGG + Intronic
960227275 3:115183551-115183573 AGGGACTAGCTGGGAGGCTGAGG + Intergenic
960972641 3:123150613-123150635 GGGGACGAGCACAGAGGCAGAGG - Intronic
961018529 3:123485307-123485329 GTGGACAAGAAAGGAGGCAGTGG + Intergenic
961473716 3:127134320-127134342 GGGACCAAGCCAGCAGGCAGCGG - Intergenic
961730097 3:128958921-128958943 GGAGACAAGGTTGGACGCAGTGG + Intronic
961743394 3:129047393-129047415 GAGGAGAGGCCAGGAGGCAGAGG - Intergenic
961805294 3:129485002-129485024 GGGGACCAGGCAGGAGGGAGGGG - Intronic
961991316 3:131195229-131195251 GGGGAAGAGCAAGCAGGCAGGGG - Intronic
967930620 3:194687790-194687812 GGGGAGGCGCTAGGAGGCGGCGG + Exonic
968280567 3:197473829-197473851 GTGGAGATGCTAGGAGGCAGTGG - Intergenic
968424977 4:517230-517252 GGAGACCAGTCAGGAGGCAGTGG + Intronic
971224265 4:24736664-24736686 GGTGTGAACCTAGGAGGCAGAGG + Intergenic
971911896 4:32804742-32804764 GGGGAGAGGCTAGGGTGCAGTGG - Intergenic
974012697 4:56622075-56622097 GGGGACAGGGTAGGGAGCAGAGG + Intergenic
975633143 4:76421474-76421496 GGAGACCAGTTAGGAGGCTGTGG - Intronic
976511173 4:85911003-85911025 AGGGAGAAGCTAGGCAGCAGGGG + Intronic
977709788 4:100112063-100112085 TGGGAGAACCCAGGAGGCAGAGG - Intergenic
979798000 4:124871264-124871286 TGGGAAAAGGTAGGAGGAAGGGG - Intergenic
982202434 4:152973635-152973657 GGGGACGAGGTGGGAGGCTGAGG + Intronic
985261004 4:188114731-188114753 GGTGAGAACCTGGGAGGCAGAGG + Intergenic
985352890 4:189085183-189085205 TGGGAGAAGCTAGAAGGGAGAGG - Intergenic
985705587 5:1399825-1399847 GGGAACAGGCCGGGAGGCAGTGG - Intronic
985868744 5:2537234-2537256 GTGGACAAAATAGGAGGTAGCGG - Intergenic
986032739 5:3909197-3909219 GGAGCCAAGAGAGGAGGCAGTGG - Intergenic
986039087 5:3969478-3969500 GGGGAGACAGTAGGAGGCAGGGG + Intergenic
987187729 5:15442635-15442657 GGGAACAAACTTGGAGGCAGAGG - Intergenic
987846726 5:23296229-23296251 GGGGAAAAGCCAGGAGTCATTGG + Intergenic
988758167 5:34282573-34282595 GGCGTGAACCTAGGAGGCAGAGG - Intergenic
988774659 5:34467028-34467050 GGTTCCAAGATAGGAGGCAGAGG + Intergenic
988832482 5:35001411-35001433 GGGGACAAGACTGGAGACAGGGG - Intronic
988980290 5:36561563-36561585 GGAGCAAAGCTAGAAGGCAGTGG + Intergenic
989414720 5:41160359-41160381 GGGGGCAAGCTAGGAGAAAATGG + Exonic
989747454 5:44847075-44847097 GGGAACAAGCTAGATGTCAGAGG + Intergenic
991010821 5:61881487-61881509 GGGGATAAGCTAGGAATCAGAGG - Intergenic
993707993 5:91193425-91193447 GGGGACAACCAAGTAGTCAGTGG + Intergenic
994092424 5:95821017-95821039 GAGGAGAACCCAGGAGGCAGAGG + Intronic
994472902 5:100232101-100232123 GGGAAGAATATAGGAGGCAGGGG + Intergenic
996263584 5:121505915-121505937 GGGGAAAAGGTGGGAGGGAGGGG + Intergenic
996310610 5:122099662-122099684 GGGGAGAAGGAAGGAGCCAGAGG + Intergenic
997995355 5:138581543-138581565 GAGGACAGGATAGGAGGAAGAGG - Intergenic
998656828 5:144190647-144190669 GGGGACAAGGAAAGAGGTAGGGG - Intronic
999201037 5:149816556-149816578 GTGAACAATCTGGGAGGCAGAGG - Intronic
999370118 5:151049838-151049860 AGGGACAGGCAAGAAGGCAGTGG - Exonic
1001227985 5:169962191-169962213 GGGAGCAAGATTGGAGGCAGAGG + Intronic
1001936544 5:175709656-175709678 GGGGAGAAGCCAGCAGACAGTGG - Intergenic
1003863598 6:10343803-10343825 CCGGAGAAGGTAGGAGGCAGGGG - Intergenic
1004393364 6:15227607-15227629 GGGGACAAGCGGGGTGGGAGTGG + Intergenic
1004578722 6:16926244-16926266 GGGGAGAGGGTAGGAGGCCGAGG + Intergenic
1005040292 6:21594997-21595019 GGAGACAAGGTCGGTGGCAGTGG + Exonic
1005966858 6:30732736-30732758 CGGGGGAAGGTAGGAGGCAGGGG - Intronic
1006303429 6:33205904-33205926 GTGGACAAGGTAGGAGGCTGTGG + Exonic
1007240939 6:40424855-40424877 GGGGAGAAGCTAGTGGGAAGTGG - Intronic
1007628071 6:43257748-43257770 GGGGGCTAGCCAGGAGGAAGGGG - Intronic
1007679034 6:43621760-43621782 GCGGACAGGCGAGAAGGCAGTGG - Exonic
1007712751 6:43835037-43835059 GGGGACAATGGAGGAGGTAGGGG + Intergenic
1008272550 6:49507061-49507083 GGTTCCAAGATAGGAGGCAGAGG + Intronic
1011755887 6:90497859-90497881 GGGTACAAGCTCAGAGTCAGAGG + Intergenic
1012534306 6:100277502-100277524 AGGGACAATATGGGAGGCAGTGG + Intergenic
1013366308 6:109440778-109440800 GGGGACGAGCTTGGAGGAAAAGG + Exonic
1016313573 6:142760454-142760476 GAGGAGAATCTAGGAGGCTGAGG + Exonic
1016614070 6:146027513-146027535 GGAGACAAACTAGGAGGAAGTGG - Intergenic
1016615425 6:146042274-146042296 GGGCAGAAGCCAGGAGGAAGTGG + Intronic
1018861283 6:167712506-167712528 GGGCAGAAGCCAGCAGGCAGCGG - Intergenic
1019299698 7:296871-296893 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019299734 7:296993-297015 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019299770 7:297115-297137 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019299788 7:297176-297198 GAGGAGAAGCTGGGAGGGAGTGG + Intergenic
1019307231 7:341547-341569 GGGGACAAGCGTGGATGCCGGGG - Intergenic
1019577426 7:1744252-1744274 GGGGACAAGAGAGAAGACAGCGG - Intronic
1020118911 7:5491942-5491964 GGCGAGAATCTGGGAGGCAGGGG + Intronic
1021784140 7:24135590-24135612 GGGGACAAGCTAGCAGGTTGGGG + Intergenic
1022381928 7:29868472-29868494 GGAGACCAGCTAGGAGGCTCTGG + Intronic
1022665394 7:32405730-32405752 GGGGCCAAAGTAGTAGGCAGGGG - Intergenic
1022770208 7:33462983-33463005 AGGGACAAGCTAGGAGAAAATGG + Intronic
1023105194 7:36756907-36756929 AGGGAGAAGCTATGAAGCAGAGG + Intergenic
1023895693 7:44431199-44431221 GGGCACATGGTAGGAGGCAGGGG + Intronic
1024282574 7:47731657-47731679 GGGGAAGAGCCAGGAGGCTGAGG - Intronic
1025849914 7:65237189-65237211 GTGGAGAACCTAGAAGGCAGTGG + Intergenic
1027978462 7:85186865-85186887 GGGGCCAGGCCGGGAGGCAGGGG + Intergenic
1028712263 7:93922396-93922418 GGGGAAATCCTAGGAGGTAGAGG + Intronic
1029539458 7:101174128-101174150 GGGGAGGAGCTAAGAGGAAGTGG - Intronic
1030884751 7:114922984-114923006 GGCGGCGAGCTAGGCGGCAGCGG + Exonic
1032097631 7:128947460-128947482 GGGGGCAGGCTGGCAGGCAGGGG - Exonic
1032267425 7:130379364-130379386 GGGGGTAGGGTAGGAGGCAGTGG + Intergenic
1032465564 7:132142315-132142337 GGGGAAATGGCAGGAGGCAGAGG - Intronic
1033086588 7:138347818-138347840 GGGCTGAACCTAGGAGGCAGAGG - Intergenic
1033258599 7:139822835-139822857 GAGGACCAGCCAGGAGGCTGCGG - Intronic
1033345888 7:140525585-140525607 GAGGACAAGCCAGAAGGCAAGGG - Intronic
1033657443 7:143382885-143382907 GGGGACTTCCAAGGAGGCAGGGG - Exonic
1033794500 7:144831591-144831613 CAGGAGAAGCCAGGAGGCAGAGG + Intronic
1034252919 7:149706638-149706660 GGGGACAAGGGAGGAAGGAGAGG - Intergenic
1034255702 7:149723643-149723665 GGGGACAAGTTAGAAGGGCGTGG - Intronic
1034822524 7:154230147-154230169 GGGGAGAGGATAGGAGGGAGGGG - Intronic
1035443805 7:158925802-158925824 GGGAAGGAGCTGGGAGGCAGAGG - Intronic
1036100097 8:5771992-5772014 ATTGACAAGCTAGGAGGCGGAGG + Intergenic
1037951066 8:23019072-23019094 GGGGCAGAGCCAGGAGGCAGTGG + Intronic
1039491629 8:37952050-37952072 GGGGAGATGCTGGCAGGCAGGGG + Intergenic
1042258335 8:66829954-66829976 AGGGAGAACCTGGGAGGCAGAGG - Intronic
1043507459 8:80916422-80916444 GAGGAGAAGCTAAGAGGGAGGGG - Intergenic
1043789240 8:84442691-84442713 GGTTGCAAGCTTGGAGGCAGAGG + Intronic
1044123639 8:88429920-88429942 GGGGTGGAGGTAGGAGGCAGGGG + Intergenic
1045007267 8:97927539-97927561 AGGGACAAGCTATGAGACTGTGG + Intronic
1045628830 8:104090738-104090760 GAGGACATACTAGGAGTCAGTGG + Intronic
1046486375 8:114894083-114894105 GGGTCCAAGCTGGGGGGCAGGGG + Intergenic
1047658701 8:127008541-127008563 GGGGACAAGGAAGGAGGAAATGG + Intergenic
1047904696 8:129460387-129460409 GGGGATAAGCTGTGGGGCAGGGG - Intergenic
1049184366 8:141241733-141241755 GAGGAAAGGCTTGGAGGCAGTGG - Intronic
1049651443 8:143771644-143771666 GGGGGCCAGGCAGGAGGCAGGGG + Intergenic
1049700553 8:144009632-144009654 GGAGATGAGCCAGGAGGCAGGGG - Intronic
1049706527 8:144045695-144045717 AGGGCCAAGCCTGGAGGCAGGGG + Intronic
1049724180 8:144137877-144137899 GGAGGCAAGCCCGGAGGCAGAGG + Exonic
1049779725 8:144423405-144423427 GGGCACATAATAGGAGGCAGGGG - Intergenic
1049906927 9:226472-226494 GGAAACCAGCTGGGAGGCAGTGG + Intronic
1049990014 9:981719-981741 GGGGCAAAGATAGGGGGCAGCGG + Intronic
1050874344 9:10615410-10615432 GGGGAGGAGGTAGGAGGAAGGGG - Intergenic
1051154313 9:14123772-14123794 AGGGGCAAACTGGGAGGCAGAGG - Intronic
1051154324 9:14123812-14123834 AGGGGCAAACTAGGAGGAAGAGG - Intronic
1051154335 9:14123852-14123874 AGGGACATACTAGGAGGAAGAGG - Intronic
1051154340 9:14123872-14123894 AGGGGCAACCTGGGAGGCAGAGG - Intronic
1051291952 9:15553525-15553547 GGGGACCAGAGGGGAGGCAGAGG + Intronic
1051666581 9:19472053-19472075 GGGGACAAACCTGGAGGCTGCGG + Intergenic
1052840624 9:33289118-33289140 GGTGGCAGGCCAGGAGGCAGGGG - Intergenic
1056744444 9:89287879-89287901 GGGGAAAAGGTAGAAGGCAAGGG - Intergenic
1057208400 9:93186417-93186439 TGGGACAGCCTAGGAAGCAGAGG + Intronic
1057397796 9:94695638-94695660 GGTGTGAACCTAGGAGGCAGAGG - Intergenic
1057674541 9:97128597-97128619 GGGCCCATGTTAGGAGGCAGTGG - Intergenic
1057890223 9:98864340-98864362 GGGGCCAAGCTGGGAGCCTGGGG + Intergenic
1058339396 9:103875778-103875800 GGGGACATCCTAAGAGGCAATGG - Intergenic
1058654337 9:107206165-107206187 GGGGACAGGCTCGGAGGGAGGGG + Intergenic
1059385727 9:113962743-113962765 GGGGACAAGGGAGGAGCCACAGG - Intronic
1059549453 9:115214249-115214271 GGGGACAAGCTGTGAGCAAGGGG + Intronic
1060232832 9:121838351-121838373 GGAGACCAGCGAGGAGGCTGTGG - Intronic
1060402226 9:123355731-123355753 GGGGACGAGCTGGGTGGGAGGGG + Intergenic
1060764221 9:126281860-126281882 GGGGTCAGCCTGGGAGGCAGGGG - Intergenic
1061045527 9:128162998-128163020 CAGGGCTAGCTAGGAGGCAGGGG + Intronic
1061080718 9:128368357-128368379 AGGCACAAGCTGGGAGGCGGAGG - Intergenic
1061609368 9:131736302-131736324 AGGAACAAGCTGGGATGCAGGGG - Intronic
1061657007 9:132099913-132099935 GGGGACAGTCAGGGAGGCAGAGG + Intergenic
1061980132 9:134097770-134097792 GGGGTGAACCTGGGAGGCAGTGG + Intergenic
1061995510 9:134180916-134180938 AGGGAGGAGCCAGGAGGCAGTGG - Intergenic
1062054353 9:134463306-134463328 GGGGGACAGGTAGGAGGCAGAGG - Intergenic
1062200550 9:135300583-135300605 GGGGACAAGGTGGGTGCCAGGGG + Intergenic
1062504180 9:136865003-136865025 GGCCACAAGCTAGGAGTCATGGG - Intronic
1062700914 9:137902328-137902350 GGGGAGGGGCTAGGAGCCAGTGG - Intronic
1203568119 Un_KI270744v1:108750-108772 GGAGAGAAGCTGGGAGGCACAGG + Intergenic
1185464382 X:346132-346154 AGGGACAAGGCAGGGGGCAGGGG + Intronic
1186223014 X:7369572-7369594 AGGGCCAAGCTTGGAGGCAGAGG + Intergenic
1186530515 X:10290574-10290596 GGGAACCAGCAATGAGGCAGGGG + Intergenic
1187155894 X:16719994-16720016 GGGGCCGAGGTGGGAGGCAGGGG + Intronic
1188481012 X:30636959-30636981 GGAGAAAAGTTAGGAGCCAGAGG - Intergenic
1188669297 X:32863424-32863446 GGAGAGAATCTGGGAGGCAGAGG + Intronic
1188843410 X:35043850-35043872 GGGGACAGGCTAGAGTGCAGTGG - Intergenic
1190319972 X:49174309-49174331 GGGGACAGGATAGGAGTGAGGGG - Intronic
1190758888 X:53423464-53423486 GGGGAGAGGCATGGAGGCAGAGG - Intronic
1192313608 X:70035596-70035618 GGGGGGAATCTAGGATGCAGGGG - Exonic
1195393320 X:104385604-104385626 AGGGACAAGCTCAGAGGGAGTGG + Intergenic
1196225199 X:113157991-113158013 GGGGAAAAGCTAGCAGTCACAGG + Intergenic
1197905054 X:131415786-131415808 GTGGACAAGGTTGGGGGCAGGGG - Intergenic
1199966384 X:152824190-152824212 GGGGACAGGCAGGGAGACAGAGG - Intergenic
1200024544 X:153245812-153245834 GGTGATAAGCTAGGAGGCAATGG + Intergenic
1201358015 Y:13116534-13116556 CGGGAAAAGCTATGAGGCACAGG + Intergenic