ID: 1178488008

View in Genome Browser
Species Human (GRCh38)
Location 21:33030973-33030995
Sequence CGCCGAGGGTGGCCCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178488001_1178488008 -2 Left 1178488001 21:33030952-33030974 CCCCTAGAACAGGTGGCTACTCG No data
Right 1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG No data
1178488003_1178488008 -4 Left 1178488003 21:33030954-33030976 CCTAGAACAGGTGGCTACTCGCC No data
Right 1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG No data
1178488002_1178488008 -3 Left 1178488002 21:33030953-33030975 CCCTAGAACAGGTGGCTACTCGC No data
Right 1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178488008 Original CRISPR CGCCGAGGGTGGCCCTGGAC TGG Intergenic
No off target data available for this crispr