ID: 1178488138

View in Genome Browser
Species Human (GRCh38)
Location 21:33031714-33031736
Sequence GAGGCCAGAGGAGGAGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178488138_1178488147 2 Left 1178488138 21:33031714-33031736 CCCGAGCCTCCTCCTCTGGCCTC No data
Right 1178488147 21:33031739-33031761 CACCCCAGGGCATTGTCCCTGGG No data
1178488138_1178488156 27 Left 1178488138 21:33031714-33031736 CCCGAGCCTCCTCCTCTGGCCTC No data
Right 1178488156 21:33031764-33031786 CCTCACTCTCTCATATGGGCAGG No data
1178488138_1178488154 23 Left 1178488138 21:33031714-33031736 CCCGAGCCTCCTCCTCTGGCCTC No data
Right 1178488154 21:33031760-33031782 GGCTCCTCACTCTCTCATATGGG No data
1178488138_1178488153 22 Left 1178488138 21:33031714-33031736 CCCGAGCCTCCTCCTCTGGCCTC No data
Right 1178488153 21:33031759-33031781 GGGCTCCTCACTCTCTCATATGG No data
1178488138_1178488146 1 Left 1178488138 21:33031714-33031736 CCCGAGCCTCCTCCTCTGGCCTC No data
Right 1178488146 21:33031738-33031760 GCACCCCAGGGCATTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178488138 Original CRISPR GAGGCCAGAGGAGGAGGCTC GGG (reversed) Intergenic
No off target data available for this crispr