ID: 1178489176

View in Genome Browser
Species Human (GRCh38)
Location 21:33037133-33037155
Sequence TAAGGATACATGCAACAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178489176_1178489181 16 Left 1178489176 21:33037133-33037155 CCACGTTGTTGCATGTATCCTTA No data
Right 1178489181 21:33037172-33037194 AGTGGAATCATATTCTGTTGTGG No data
1178489176_1178489182 17 Left 1178489176 21:33037133-33037155 CCACGTTGTTGCATGTATCCTTA No data
Right 1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG No data
1178489176_1178489178 -2 Left 1178489176 21:33037133-33037155 CCACGTTGTTGCATGTATCCTTA No data
Right 1178489178 21:33037154-33037176 TACTTCATTCCTTCTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178489176 Original CRISPR TAAGGATACATGCAACAACG TGG (reversed) Intergenic