ID: 1178489177

View in Genome Browser
Species Human (GRCh38)
Location 21:33037151-33037173
Sequence CTGGAAGAAGGAATGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178489177_1178489181 -2 Left 1178489177 21:33037151-33037173 CCTTACTTCATTCCTTCTTCCAG No data
Right 1178489181 21:33037172-33037194 AGTGGAATCATATTCTGTTGTGG No data
1178489177_1178489183 15 Left 1178489177 21:33037151-33037173 CCTTACTTCATTCCTTCTTCCAG No data
Right 1178489183 21:33037189-33037211 TTGTGGGTGTCTGCCACATTTGG No data
1178489177_1178489182 -1 Left 1178489177 21:33037151-33037173 CCTTACTTCATTCCTTCTTCCAG No data
Right 1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178489177 Original CRISPR CTGGAAGAAGGAATGAAGTA AGG (reversed) Intergenic