ID: 1178489179 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:33037163-33037185 |
Sequence | AATATGATTCCACTGGAAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1178489179_1178489183 | 3 | Left | 1178489179 | 21:33037163-33037185 | CCTTCTTCCAGTGGAATCATATT | No data | ||
Right | 1178489183 | 21:33037189-33037211 | TTGTGGGTGTCTGCCACATTTGG | No data | ||||
1178489179_1178489185 | 23 | Left | 1178489179 | 21:33037163-33037185 | CCTTCTTCCAGTGGAATCATATT | No data | ||
Right | 1178489185 | 21:33037209-33037231 | TGGTTTATCCATTCATCTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1178489179 | Original CRISPR | AATATGATTCCACTGGAAGA AGG (reversed) | Intergenic | ||