ID: 1178489179 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:33037163-33037185 |
| Sequence | AATATGATTCCACTGGAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1178489179_1178489183 | 3 | Left | 1178489179 | 21:33037163-33037185 | CCTTCTTCCAGTGGAATCATATT | No data | ||
| Right | 1178489183 | 21:33037189-33037211 | TTGTGGGTGTCTGCCACATTTGG | No data | ||||
| 1178489179_1178489185 | 23 | Left | 1178489179 | 21:33037163-33037185 | CCTTCTTCCAGTGGAATCATATT | No data | ||
| Right | 1178489185 | 21:33037209-33037231 | TGGTTTATCCATTCATCTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1178489179 | Original CRISPR | AATATGATTCCACTGGAAGA AGG (reversed) | Intergenic | ||