ID: 1178489182

View in Genome Browser
Species Human (GRCh38)
Location 21:33037173-33037195
Sequence GTGGAATCATATTCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178489176_1178489182 17 Left 1178489176 21:33037133-33037155 CCACGTTGTTGCATGTATCCTTA No data
Right 1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG No data
1178489177_1178489182 -1 Left 1178489177 21:33037151-33037173 CCTTACTTCATTCCTTCTTCCAG No data
Right 1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178489182 Original CRISPR GTGGAATCATATTCTGTTGT GGG Intergenic
No off target data available for this crispr