ID: 1178489201

View in Genome Browser
Species Human (GRCh38)
Location 21:33037349-33037371
Sequence AGCGAGTTGCTTGACCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178489196_1178489201 23 Left 1178489196 21:33037303-33037325 CCAGGAGTTTAAAAATCTACGTC No data
Right 1178489201 21:33037349-33037371 AGCGAGTTGCTTGACCTTTCTGG No data
1178489198_1178489201 -5 Left 1178489198 21:33037331-33037353 CCAGGTTGAGCATCCTCCAGCGA No data
Right 1178489201 21:33037349-33037371 AGCGAGTTGCTTGACCTTTCTGG No data
1178489195_1178489201 29 Left 1178489195 21:33037297-33037319 CCTGTTCCAGGAGTTTAAAAATC No data
Right 1178489201 21:33037349-33037371 AGCGAGTTGCTTGACCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178489201 Original CRISPR AGCGAGTTGCTTGACCTTTC TGG Intergenic
No off target data available for this crispr