ID: 1178489436

View in Genome Browser
Species Human (GRCh38)
Location 21:33039591-33039613
Sequence AGGATAAATACAACCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178489436_1178489443 28 Left 1178489436 21:33039591-33039613 CCCTCAGTGGTTGTATTTATCCT No data
Right 1178489443 21:33039642-33039664 TTGGCTGAACTAACTCAGCCTGG No data
1178489436_1178489439 9 Left 1178489436 21:33039591-33039613 CCCTCAGTGGTTGTATTTATCCT No data
Right 1178489439 21:33039623-33039645 ACTGTCCCCTTTGTTGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178489436 Original CRISPR AGGATAAATACAACCACTGA GGG (reversed) Intergenic
No off target data available for this crispr